ID: 1090575607

View in Genome Browser
Species Human (GRCh38)
Location 11:128099574-128099596
Sequence TCTCATTTTTTAATCTCCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090575602_1090575607 21 Left 1090575602 11:128099530-128099552 CCAGTTGAGGTCTGACTGCCTGT No data
Right 1090575607 11:128099574-128099596 TCTCATTTTTTAATCTCCCATGG No data
1090575604_1090575607 3 Left 1090575604 11:128099548-128099570 CCTGTTAGTAGCCAGCCTTGGAA No data
Right 1090575607 11:128099574-128099596 TCTCATTTTTTAATCTCCCATGG No data
1090575605_1090575607 -8 Left 1090575605 11:128099559-128099581 CCAGCCTTGGAAATGTCTCATTT No data
Right 1090575607 11:128099574-128099596 TCTCATTTTTTAATCTCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090575607 Original CRISPR TCTCATTTTTTAATCTCCCA TGG Intergenic
No off target data available for this crispr