ID: 1090575609

View in Genome Browser
Species Human (GRCh38)
Location 11:128099585-128099607
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090575605_1090575609 3 Left 1090575605 11:128099559-128099581 CCAGCCTTGGAAATGTCTCATTT No data
Right 1090575609 11:128099585-128099607 AATCTCCCATGGTCATCTATGGG No data
1090575606_1090575609 -1 Left 1090575606 11:128099563-128099585 CCTTGGAAATGTCTCATTTTTTA No data
Right 1090575609 11:128099585-128099607 AATCTCCCATGGTCATCTATGGG No data
1090575604_1090575609 14 Left 1090575604 11:128099548-128099570 CCTGTTAGTAGCCAGCCTTGGAA No data
Right 1090575609 11:128099585-128099607 AATCTCCCATGGTCATCTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090575609 Original CRISPR AATCTCCCATGGTCATCTAT GGG Intergenic
No off target data available for this crispr