ID: 1090580652

View in Genome Browser
Species Human (GRCh38)
Location 11:128154968-128154990
Sequence TGCCTCGGAGATGGGTCTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090580647_1090580652 -2 Left 1090580647 11:128154947-128154969 CCGAAAATCTCAGACACATGTTG No data
Right 1090580652 11:128154968-128154990 TGCCTCGGAGATGGGTCTTTGGG No data
1090580645_1090580652 15 Left 1090580645 11:128154930-128154952 CCAAAATCTCCAATGCTCCGAAA No data
Right 1090580652 11:128154968-128154990 TGCCTCGGAGATGGGTCTTTGGG No data
1090580646_1090580652 6 Left 1090580646 11:128154939-128154961 CCAATGCTCCGAAAATCTCAGAC No data
Right 1090580652 11:128154968-128154990 TGCCTCGGAGATGGGTCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090580652 Original CRISPR TGCCTCGGAGATGGGTCTTT GGG Intergenic
No off target data available for this crispr