ID: 1090586941

View in Genome Browser
Species Human (GRCh38)
Location 11:128223197-128223219
Sequence TGTCCTTTGCAGGACATGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 460
Summary {0: 9, 1: 29, 2: 37, 3: 84, 4: 301}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090586941_1090586945 16 Left 1090586941 11:128223197-128223219 CCATCCATGTCCTGCAAAGGACA 0: 9
1: 29
2: 37
3: 84
4: 301
Right 1090586945 11:128223236-128223258 TACGACTACATAGTATTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090586941 Original CRISPR TGTCCTTTGCAGGACATGGA TGG (reversed) Intergenic
900758387 1:4454023-4454045 TGTCCTGGGCAAGAGATGGAGGG - Intergenic
902086951 1:13870280-13870302 TGTCCTTTGCAGGACACAGGAGG - Intergenic
904026175 1:27504972-27504994 TGTCCTCTGCAAAACAGGGAAGG - Intergenic
904227288 1:29033081-29033103 TTTCTTTTTCAGGACTTGGAAGG + Exonic
904678986 1:32215785-32215807 TGCCCTCTGCAGGAGGTGGAAGG - Exonic
905154545 1:35964428-35964450 TGTACTCTGCAGAACATGTATGG - Intronic
906020290 1:42622240-42622262 TGTCATTTGCAATACATGGATGG - Intronic
906283294 1:44568586-44568608 ACTCCTTTGCAGGATTTGGAAGG + Intronic
906870900 1:49479607-49479629 TGTCCTTTGCATGACATGGATGG - Intronic
907933697 1:59022972-59022994 TGTCCTTTGCAGGCAGGGGATGG + Intergenic
909460160 1:75902506-75902528 TGTCCTTTACACAACATAGATGG - Intronic
909794511 1:79716732-79716754 TGTTCTTGGCAGGCCCTGGAAGG + Intergenic
910436638 1:87212116-87212138 CTTCCCTTGCAGGACATGGCTGG + Intergenic
910733644 1:90427287-90427309 TGTCATTTGCAACAAATGGATGG + Intergenic
911100491 1:94092205-94092227 TGGCCTCTGCAGGCTATGGAAGG + Intronic
911710590 1:101067106-101067128 CCTCCTTTGCAGGACATGGATGG - Intergenic
913113575 1:115677372-115677394 TTTTCTTTGCAGGACAAAGAGGG - Intronic
913343434 1:117783158-117783180 TGTCATTTGCAGGAGTGGGAAGG + Intergenic
913715061 1:121525204-121525226 TGTCCTTTGTAGGAAATAGATGG + Intergenic
914994258 1:152527576-152527598 TGTCTTTTACAGAACATGGATGG - Intronic
915763990 1:158344428-158344450 TGCCCTTTATAGGACATGGATGG - Intergenic
916247286 1:162701327-162701349 TGGCATTTGCAGTAAATGGAAGG + Intronic
917104897 1:171482680-171482702 TCTCCTTAGCAGCACTTGGATGG - Intergenic
919204586 1:194405750-194405772 TGTTCTTTGCAGGACATGGATGG + Intergenic
919598744 1:199596594-199596616 TGTCCTTTGCAGGAAATGGATGG - Intergenic
920813751 1:209311447-209311469 CATACTTTGCAGGGCATGGATGG + Intergenic
921298846 1:213730075-213730097 TGTTCTTTACTGGACATGGATGG - Intergenic
1062826520 10:572953-572975 TGTCCTTTGTAGGATATTCAGGG - Intronic
1063352034 10:5364924-5364946 TGTCGTCTGCATGACGTGGACGG + Intergenic
1065294335 10:24260021-24260043 TGTCTCTTGTAGGAAATGGAGGG + Intronic
1065700014 10:28415732-28415754 TGTCTTTTGCGGAACATGGATGG - Intergenic
1065760941 10:28982907-28982929 TGTCCCTTGGAGCACATGAAGGG + Intergenic
1069345969 10:67470251-67470273 TGTCATTTGCAAAACATGGTTGG - Intronic
1069935792 10:71915228-71915250 TGGCCTTAGCAGGACATGGGTGG - Intergenic
1070053985 10:72916476-72916498 TGTCCTTTGCAGGGAGTGGATGG - Intronic
1070444253 10:76479533-76479555 TGTGCTCTGCAGGACATTAAAGG - Intronic
1070739857 10:78895667-78895689 TCTCATTTGCAGGACAAGAAGGG - Intergenic
1070949346 10:80418554-80418576 TCTCCCTTGCAGGACTTGGCCGG - Intronic
1073084668 10:100880396-100880418 TGTTATTTGCAGAACAGGGATGG - Intergenic
1073952948 10:108831848-108831870 TGTCCTTTCCAGGACATGGATGG + Intergenic
1074022718 10:109600824-109600846 CATCCTTTGAAGGACATGGATGG + Intergenic
1074534713 10:114320533-114320555 TCTCCTTGGCAGGACAGGCAGGG + Intronic
1074733270 10:116400196-116400218 TGTCCTCTGAAGGACCTGGCTGG + Intergenic
1075187598 10:120277033-120277055 TGTCCTTTGAAGGACATGGATGG + Intergenic
1075500508 10:122969498-122969520 TTTTTCTTGCAGGACATGGATGG + Intronic
1075581706 10:123623769-123623791 TCTCACTGGCAGGACATGGATGG - Intergenic
1075795119 10:125114762-125114784 TGTACTCTGCATGGCATGGAAGG + Intronic
1078130060 11:8606142-8606164 TGTCCCTGGCAGGACAGGGTGGG + Intergenic
1078517753 11:12039156-12039178 TGTCCTTTGCAGCACATGGATGG + Intergenic
1078864670 11:15286185-15286207 TGTGCTTTGCAGGACATGAGAGG + Intergenic
1078975287 11:16467475-16467497 TGTCCTTTGCAGGACATGGATGG + Intronic
1079259676 11:18866270-18866292 TTTCCTTTTCAGGACAACGAAGG - Intergenic
1079295740 11:19232017-19232039 TGTCCTCTGTGGGACACGGATGG + Intronic
1079351663 11:19697117-19697139 TGCCCTTTGCAGCAAATGGGTGG + Intronic
1079920324 11:26425845-26425867 TGTACTTTGGAGTAAATGGATGG + Intronic
1081307330 11:41529538-41529560 TGTCCTTTGCATGAGATAGAAGG + Intergenic
1082171604 11:49011861-49011883 TGTTCTTTGCAGGACAGAGTTGG - Intergenic
1082904093 11:58287185-58287207 TGTCTTTTGCAGAACATAGATGG + Intergenic
1082907462 11:58325702-58325724 TGTCCTTTGCAGGAACAAGATGG - Intergenic
1083319802 11:61838690-61838712 TGGCCTTTGAAGGACCTGCAGGG - Intronic
1083677794 11:64336705-64336727 TGTCCTTCGTGGGACATGGATGG - Intergenic
1083827893 11:65213534-65213556 TGTCCTCTGGAGGAAAGGGAAGG + Intergenic
1083919649 11:65775433-65775455 TGTCCTTTGAAGGATATGGATGG + Intergenic
1084131825 11:67141973-67141995 TGTCATTTTCGGAACATGGATGG - Intronic
1084765800 11:71307549-71307571 AGTCCTTTACAAGACATGGAAGG - Intergenic
1085141304 11:74144754-74144776 TGTCCTTTGCAGGACATGGATGG - Intronic
1086236564 11:84638251-84638273 TGTCCTTGGCACCAAATGGAAGG + Intronic
1087585311 11:100112035-100112057 TATCCTTTCCAGCACATGGAGGG + Intronic
1088852948 11:113720351-113720373 TGTCCTTAGCATGGCATGAAAGG + Intergenic
1089144038 11:116311319-116311341 TGTCCTTTTCAGACCATGGAGGG - Intergenic
1089494665 11:118902091-118902113 CGTCCTCTGCAGGACATGATGGG - Exonic
1090428913 11:126629672-126629694 AGGCCTTGGCAGGACATGGGCGG + Intronic
1090490053 11:127152411-127152433 TGTCATTTACAGGACATCTAAGG + Intergenic
1090586941 11:128223197-128223219 TGTCCTTTGCAGGACATGGATGG - Intergenic
1091348666 11:134874774-134874796 AGTCCTTGGAAGGACATGGAAGG + Intergenic
1092098304 12:5862204-5862226 TGGCCTATGCAGGACAGGGTTGG - Intronic
1093084937 12:14856439-14856461 TGTCTTTTGGATGTCATGGATGG - Intronic
1093415775 12:18918975-18918997 CGTTCTTTGCAGGGCATGGCTGG + Intergenic
1094300352 12:28957808-28957830 TCTCCTTTGAAAGAAATGGAGGG - Intergenic
1097419318 12:59354369-59354391 TGTCCTTTCAGAGACATGGATGG - Intergenic
1097538359 12:60902502-60902524 TGTCATTTGCAACACATGGATGG + Intergenic
1097627840 12:62022231-62022253 AGTCTTTAGCAGGACATGTAAGG - Intronic
1098033545 12:66279313-66279335 TGTCCTCTGCTGGTCATGGTTGG - Intergenic
1098118439 12:67206702-67206724 TGTCATTTGCACAACATAGATGG + Intergenic
1099302524 12:80915711-80915733 TGTGCTTTGCAGCAACTGGATGG + Intronic
1099374867 12:81886782-81886804 AGTCCTTTACAAGACATGCAAGG - Intergenic
1099435669 12:82642466-82642488 ATGTCTTTGCAGGACATGGATGG + Intergenic
1101000555 12:100353436-100353458 TGTTCTTTGCAGGGACTGGATGG - Intergenic
1101143156 12:101816881-101816903 TGTAATTTGCAGCGCATGGATGG + Intronic
1101344752 12:103876513-103876535 TGTCCTTTGCAGGAACAGGGAGG + Intergenic
1102402192 12:112639336-112639358 TGTCCTTTGCAGGCTATGGATGG + Intronic
1102806916 12:115790120-115790142 TGTCATTTGCAGAACATGGATGG - Intergenic
1104745428 12:131207514-131207536 TGTCCTCGGCTGGACCTGGAAGG - Intergenic
1104788912 12:131469592-131469614 TGTCCTCGGCTGGACCTGGAAGG + Intergenic
1104796459 12:131523204-131523226 TATCCTTTGCAGGACATGGATGG + Intergenic
1105219468 13:18312329-18312351 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1107643540 13:42470256-42470278 TGTCATTTGCACAAGATGGATGG + Intergenic
1108713197 13:53054391-53054413 TGGCCTTTTCAGAACATGCATGG + Intergenic
1108738978 13:53314998-53315020 TGTCTTTTGCAGAACTTGGGTGG + Intergenic
1109759996 13:66815609-66815631 TGTCCTTTGCAGGATACTGTAGG + Intronic
1110290400 13:73799099-73799121 CGTCTTTTGCAGCACATGGATGG + Intronic
1110440023 13:75517369-75517391 TCTCCTTTGCAAGTCATTGAGGG - Intergenic
1110894433 13:80731566-80731588 TGTCTTTTCAGGGACATGGATGG - Intergenic
1110972907 13:81788854-81788876 AGTCATTTGCAGAACGTGGATGG - Intergenic
1112711891 13:102138667-102138689 TGTCCTGTTCAGGACACTGAGGG - Intronic
1113307291 13:109092420-109092442 TGTCGTTTGTGGAACATGGATGG + Intronic
1113420454 13:110167319-110167341 TGTGCTTTCCAGAACATTGAGGG - Intronic
1113747124 13:112752914-112752936 TGTCCTTTGGAGTTAATGGAGGG + Intronic
1114829139 14:26118231-26118253 TGTCCTTTGCAGGACATGGATGG + Intergenic
1115175333 14:30555558-30555580 TTTCCTTTTCAGGAAAAGGATGG - Intergenic
1115329079 14:32174669-32174691 TGTCTTTTGCAGCATGTGGATGG - Intergenic
1115764714 14:36611837-36611859 TGTTTTTTGCAGGACATGGATGG + Intergenic
1116035544 14:39622798-39622820 TGTCCTTGGCAGGACATGGATGG - Intergenic
1116900335 14:50356518-50356540 TGTCCTTTGCAGGGACAGGATGG + Intronic
1116943687 14:50816036-50816058 TGTCCTTTGCAAGACATAGATGG + Intronic
1117842462 14:59873976-59873998 TGTCATTTGCACAACATGGATGG - Intergenic
1119583492 14:75809869-75809891 TGTCATTTGCAGAACATAGATGG - Intronic
1119811521 14:77524692-77524714 TGTCATTTGCACAAGATGGATGG + Intronic
1120058955 14:79959374-79959396 TGTCCTTTGAGGGACATGGATGG + Intergenic
1120328240 14:83055500-83055522 TGTCCTTTTTAGAACATGAATGG - Intergenic
1122198320 14:100106577-100106599 TCTCCTTTGCAGTACATGTAAGG + Intronic
1125127658 15:36242859-36242881 TGTCCTTTGCAGGGACAGGAAGG - Intergenic
1126828426 15:52574451-52574473 TGTCATTTGCAGCAACTGGATGG - Intergenic
1130109310 15:80951670-80951692 TGTCCTTTGCATTGCTTGGAAGG + Exonic
1130181045 15:81628909-81628931 TGTCCTTTGCAGGGCGCGGATGG + Intergenic
1132245293 15:100291679-100291701 TGTCCTCTGCAGCACATGGATGG + Intronic
1132248813 15:100318045-100318067 GGACATTTGCAGGACATGGAAGG + Intronic
1132701701 16:1224875-1224897 TTTCCTGAGCAGGACCTGGAGGG - Intronic
1132834802 16:1947375-1947397 TTTCATCTGCAGGACATGGCCGG + Exonic
1133281532 16:4668253-4668275 TCTCCCCTGCAGCACATGGACGG + Exonic
1134388089 16:13793148-13793170 TGTCCTTTCCAGGTCAATGATGG - Intergenic
1135580607 16:23622968-23622990 TGACGTTTGCAGAAGATGGAGGG - Exonic
1136098459 16:27975517-27975539 TGTCCTCTACAGGACGTGCAGGG + Intronic
1136528364 16:30848329-30848351 TGTCCTTTGTAGGCCAAGTAAGG + Intronic
1137811424 16:51356487-51356509 TGGCCTCTGCGTGACATGGAGGG - Intergenic
1137906106 16:52323525-52323547 GGTCCTTAGCACGACCTGGAAGG - Intergenic
1138275716 16:55732789-55732811 CGTCCCTTGCAAGACATAGATGG - Intergenic
1138281612 16:55776181-55776203 CATCCTTTGCAAGACATAGATGG - Intergenic
1138510125 16:57503920-57503942 GGTCCCTTGCAGGACAGGGCTGG - Intergenic
1138872977 16:60915075-60915097 TTTCCTTTGCAAAACATAGAGGG + Intergenic
1140509815 16:75498910-75498932 TGTCCTTTGCAGGAAGGGGGAGG + Intergenic
1140515611 16:75539118-75539140 TGTCCTTTGCAGGAAGGGGGAGG + Exonic
1141260244 16:82446909-82446931 TGGCATTTGCAGCACCTGGATGG + Intergenic
1141419860 16:83906975-83906997 TCTCCTTTTCAGGAAATGAATGG + Exonic
1141483474 16:84322859-84322881 TGTCTTGGGCAGGACAAGGAGGG - Intronic
1142306903 16:89290823-89290845 TGTCCACTGCAGGCCAAGGAGGG + Exonic
1143025094 17:3936875-3936897 TGTGTGTTGCTGGACATGGATGG - Intronic
1144239669 17:13297937-13297959 GGTCCTTTGTAGGAAATGAAGGG + Intergenic
1144655508 17:17032680-17032702 TTTCTTTTTCAGGACATGCAGGG - Intergenic
1145939650 17:28736077-28736099 TGTCCTTTGTAGGACATGGATGG - Intronic
1146732345 17:35204599-35204621 TATCCTGTGCATGACTTGGAGGG - Intergenic
1150144372 17:62755375-62755397 TCTCCTTTCCAGGACACGAAGGG - Intronic
1151052184 17:70990839-70990861 TGTCTATTGCAGGAGATGAAAGG + Intergenic
1151362455 17:73596775-73596797 TGTCATCTGGAGGCCATGGAGGG - Intronic
1151973777 17:77472474-77472496 GCTCCTTTGCAGGACCTGGAAGG - Intronic
1152001431 17:77647853-77647875 TGCTCTTTGCAGGGCCTGGAAGG + Intergenic
1152799301 17:82323528-82323550 TGAGCTTTGCAGGAAAGGGAGGG + Intronic
1153474841 18:5488260-5488282 TGTCCTTTTCAGGACATGGATGG + Intronic
1153779241 18:8479482-8479504 TCTCCTTTGCACCACATGCAGGG + Intergenic
1153837250 18:8974975-8974997 TGTCATTTGCAAAACATGGATGG + Intergenic
1153881778 18:9427492-9427514 TGCCCTTTGAAGGCCAAGGAAGG - Intergenic
1154106829 18:11530894-11530916 TGTCCTTCGCAGGCCACGGCAGG - Intergenic
1154166718 18:12020683-12020705 TATGCTTTGCAGGAAATTGAGGG - Intronic
1154302811 18:13209246-13209268 TGTCCTTTGCAGGATGTGGATGG - Intergenic
1154340563 18:13498950-13498972 TGTCCACAGCAGGACATGTATGG - Intronic
1154370065 18:13752322-13752344 TCTCATTTGCAGGATATGGCTGG - Exonic
1155630801 18:27889835-27889857 TGTCCTTTGCACAACATTCAAGG + Intergenic
1156715364 18:40002561-40002583 TGTATTTTGCAGAACATGGATGG + Intergenic
1157182098 18:45507019-45507041 TGTCCTTTCCTGTACATTGAAGG + Intronic
1159421669 18:68228750-68228772 TGTCCCAAGGAGGACATGGAGGG + Intergenic
1160081765 18:75734559-75734581 TGTCCTTTGCAGGACATGGATGG - Intergenic
1160513850 18:79467722-79467744 TTTCCTTTTCAGGGCATCGATGG - Intronic
1161076402 19:2287970-2287992 TGTCCTCTGGAGGATGTGGAGGG + Intronic
1161605216 19:5211064-5211086 TGGCCCTTGAAGGAGATGGAGGG - Intronic
1161846875 19:6716770-6716792 TCTCATTTGCAGGACATGGCAGG + Intronic
1165478683 19:36048209-36048231 TGTCCTTTGCAGGTCATTTGTGG - Intronic
1165945797 19:39441461-39441483 TGTCCTTCACAGGACAGGCAAGG - Intronic
1166665170 19:44675408-44675430 TGTGTTTTGCAGGAGATGTAGGG - Intronic
1168354324 19:55692239-55692261 TGTGCCTTGGAGGACATGGGGGG + Intronic
925597698 2:5572362-5572384 AGTCCTTTTCTGGACAAGGAAGG + Intergenic
927085124 2:19667536-19667558 TGTCTTTTGCAGGCCTTGAATGG + Intergenic
928258685 2:29747587-29747609 GGTCCTGTGCTGGACATTGAGGG - Intronic
928494932 2:31821936-31821958 TGTTATTTGCAGAACATGTATGG - Intergenic
928955419 2:36862072-36862094 TGTCCTTTGCAGGAAAATCATGG - Intronic
929819262 2:45260271-45260293 TTTCCTCTGCAGGGTATGGATGG - Intergenic
930191593 2:48465723-48465745 TGTCCTTTGCAGTACTTGGATGG - Intronic
931502148 2:62881080-62881102 TGTTCTTTGCAGCACATGGATGG + Intronic
931531605 2:63221005-63221027 TGTCCTTTGAGGGACAGGGATGG - Intronic
931599214 2:63986412-63986434 TGTCATTTGCAACAGATGGATGG - Intronic
931779762 2:65568808-65568830 TGGCCTTTGCAGCACATGGGTGG - Intergenic
931798415 2:65734362-65734384 TTTTTTTTGCAGGACATGGATGG - Intergenic
932583038 2:73004963-73004985 TGCCCTTTCCAGAACATGGCAGG + Intronic
932647463 2:73518268-73518290 TGTCTTTTGCAGAACATGGATGG - Intronic
932750909 2:74371166-74371188 TCTCCTTTGCAGGAGGAGGAGGG - Exonic
932977293 2:76618693-76618715 TGTCATTTGCAGTACATGGGTGG - Intergenic
933196614 2:79397372-79397394 TGTCCTTGGCTGGAAAAGGAAGG - Intronic
933698765 2:85239333-85239355 TGTCCGTGGCAGGGCAGGGAGGG - Intronic
934184580 2:89660188-89660210 CCTTCTTTGCAGGAGATGGATGG + Intergenic
934294862 2:91734326-91734348 CCTTCTTTGCAGGAGATGGATGG + Intergenic
935627380 2:105182536-105182558 AGTCATTTGCACCACATGGATGG - Intergenic
937464304 2:122116921-122116943 TGTCATTTTCAGCACATGGATGG - Intergenic
937735966 2:125289750-125289772 TGTCCTTTGCGGGACATGGATGG - Intergenic
937946085 2:127338635-127338657 TGTCCTTTCAGGAACATGGATGG - Intronic
942705655 2:178769074-178769096 TGTCCTGTATAGTACATGGAAGG - Intronic
944938214 2:204592124-204592146 TGACCTTTGTAGGAGATGGCTGG + Intronic
945300108 2:208208145-208208167 TTTCATTTGCAGGACATAAAGGG - Intergenic
945377472 2:209096304-209096326 TGCTCTTTGCAGAACATGGATGG - Intergenic
946947026 2:224831806-224831828 TGTCCTCTGGAGGTCCTGGAGGG + Intronic
947393144 2:229660424-229660446 TGTCCTTGCAGGGACATGGATGG - Intronic
947584919 2:231349267-231349289 AGTCATTTGCAAAACATGGATGG + Intronic
1169010368 20:2245175-2245197 TGTTCTGTGCAGGAAGTGGAGGG + Intergenic
1170282260 20:14663170-14663192 TGTTCTTTGTAGGACAGGGATGG + Intronic
1170331314 20:15213829-15213851 TGTCCTTCCTAGGACATGGCTGG - Intronic
1170708810 20:18770229-18770251 CGTCATTTGCAAAACATGGATGG - Intergenic
1170728028 20:18947290-18947312 TGTGCTTTGCAGGAGGTGGTGGG - Intergenic
1171035917 20:21712990-21713012 TGTCCTATGGAGGGAATGGAGGG + Intronic
1173833118 20:46105457-46105479 TTTCCTTTGTAGAACAAGGATGG + Intergenic
1174431739 20:50475113-50475135 TGTCCTCTGCAGGGCATGGCAGG + Intergenic
1174521132 20:51131635-51131657 TTTCATTTGCAGGACATCAAGGG + Intergenic
1176254712 20:64145949-64145971 AGGCCTGGGCAGGACATGGAGGG - Intergenic
1177204248 21:17993519-17993541 TGTCCTTTGCAGGAACATGATGG - Intronic
1177218562 21:18160637-18160659 TGTCCTTGCAGGGACATGGATGG - Intronic
1177764848 21:25445870-25445892 TGTCTCTTGCAGAACATAGATGG + Intergenic
1178185153 21:30209899-30209921 AGTCCTTCTCAGGACAAGGAAGG + Intergenic
1179114918 21:38482110-38482132 GGTCCCTTCCAGGCCATGGATGG - Intronic
1179410128 21:41156120-41156142 GGCTCTTTGCAGGATATGGATGG + Intergenic
1180817070 22:18797189-18797211 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1181203259 22:21231534-21231556 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1181683074 22:24509263-24509285 TCTCCTATGCAGGGGATGGAGGG - Intronic
1183492367 22:38123388-38123410 TGTCCTATGCAGGACAGCGAGGG + Intronic
1183587672 22:38762449-38762471 TGTCCTGGGCAGGACTTGGGTGG - Intronic
1184563086 22:45274756-45274778 TGCCCTATGCAGGACACGGGAGG + Intergenic
1184884912 22:47337446-47337468 TCTCCATTGAAGGACCTGGAGGG + Intergenic
1184931062 22:47681819-47681841 TGTGCTCAGCAGGACATGGTGGG + Intergenic
1203223660 22_KI270731v1_random:63890-63912 CCTTCTTTGCAGGAGATGGATGG + Intergenic
1203267169 22_KI270734v1_random:22910-22932 CCTTCTTTGCAGGAGATGGATGG - Intergenic
949822095 3:8126500-8126522 TCTCTTTTGCAGCACAAGGAAGG + Intergenic
950953877 3:17029910-17029932 TGTCCTTTGCAAAACATGCCAGG - Intronic
951755448 3:26086445-26086467 TGTCCTTTGCAGTGAAAGGATGG - Intergenic
953816016 3:46157387-46157409 TGTCCTTTGCAAGGAATGGATGG - Intergenic
954831735 3:53426797-53426819 TGTCCCTTGCAGAAACTGGATGG - Intergenic
955125694 3:56109324-56109346 TGTCTTTTGTGGAACATGGATGG - Intronic
956687811 3:71847400-71847422 TATCATTTGCAGGAGATGGAGGG - Intergenic
957221061 3:77382721-77382743 CGTCTTTTGCAGCAAATGGATGG - Intronic
957482732 3:80819356-80819378 TGTCCTTTGTGCAACATGGATGG + Intergenic
958023462 3:88023885-88023907 TGTCATTTGCAGCAACTGGATGG + Intergenic
959398395 3:105869169-105869191 TGTACTGTGGAGGACGTGGACGG - Intronic
959773740 3:110132074-110132096 TGTCCTTTGCAGGACATAGATGG + Intergenic
960265282 3:115614345-115614367 TGTCCTTTGCAGGGACTAGATGG + Intergenic
960766593 3:121136917-121136939 TGGCCTTTTCAGCACATAGAGGG + Intronic
960825996 3:121785169-121785191 TGTCCTTGGCAGGAAAAGAAAGG - Intronic
961971551 3:130973587-130973609 TGTCCTTGGCAGGACAGAGTGGG + Intronic
962089391 3:132227327-132227349 TGTCCTTTGCAGGGAATGGAGGG - Intronic
962316469 3:134362540-134362562 TGTTCTTTTCAGACCATGGAAGG - Intronic
963532545 3:146489006-146489028 TGTCCTTTGCAGGACATGGATGG + Intronic
963747381 3:149138513-149138535 TGTAATTTGGAGGACATGGATGG + Intronic
964016208 3:151950224-151950246 TGTTCTTTGCAGGAACAGGATGG + Intergenic
965295383 3:166938716-166938738 TGTTTTTTGCAGAACATGTATGG - Intergenic
965989265 3:174796526-174796548 TGTCTTTAGCACAACATGGATGG - Intronic
965993851 3:174854218-174854240 TATCTTTTGCAGTACATGGATGG + Intronic
966323672 3:178730493-178730515 TGGCCTTTGCAGGGCAAGGGTGG - Intronic
966654800 3:182343833-182343855 TGTTCTTTGCAGCACATGGATGG - Intergenic
967580355 3:191145899-191145921 TGTCCTTTGCAGGGACAGGAGGG - Intergenic
967787605 3:193514384-193514406 TGTCCTTTTCAGGACATGGATGG - Intronic
969051463 4:4376260-4376282 TGGCCTTTGCAGGACAGGACAGG - Intronic
969082570 4:4630667-4630689 TGTCCCCTGCAGGACATGGATGG + Intergenic
970173006 4:13307988-13308010 TGATCTTTGCAGGCCATGGTAGG - Intergenic
970457529 4:16239853-16239875 TGTCCTTTGCAAGGAATGGGTGG + Intergenic
970836104 4:20409373-20409395 TGTCCTTTTAGGGACATGGATGG - Intronic
971620199 4:28845786-28845808 TGTTCTTTGCAGGACATGGATGG - Intergenic
972213176 4:36863092-36863114 TGTCTTTTGCACAACTTGGATGG + Intergenic
972910663 4:43812649-43812671 TGTCCTTTGCAGAGCGTGGATGG + Intergenic
972984854 4:44750733-44750755 TGTCCTTTCCGGGACATGGATGG - Intergenic
972986729 4:44774220-44774242 TGTCCTTAGGATGACCTGGAGGG - Intergenic
973066627 4:45802830-45802852 TGTCCCTTCCAGGACATGAGGGG + Intergenic
974392200 4:61285889-61285911 TCTCCTTTGCATGAGTTGGAGGG - Intronic
974495436 4:62620198-62620220 TCTCCTTGGCAGAACATAGAAGG + Intergenic
974986806 4:69037463-69037485 TGTATTTTACAGGACATAGATGG - Intronic
975398816 4:73910098-73910120 TGTCCTTGTAGGGACATGGATGG + Intergenic
975889090 4:79003447-79003469 TGTCCTTTCAGGGACATGGATGG + Intergenic
976793270 4:88904456-88904478 TGTCCTTTCTAGGACATGGATGG + Intronic
977520153 4:98072248-98072270 TGTCCTTTGCGGGACATGAATGG + Intronic
979141186 4:117176726-117176748 TGTCCTCTGATGAACATGGATGG - Intergenic
979300801 4:119085124-119085146 TGTCTTTTGCAGTAAATGGTTGG + Intergenic
979553787 4:122021589-122021611 TGTCCTTTGCACAACATCGTTGG + Intergenic
980282758 4:130741797-130741819 TATCCTTTGGAGAACATGGATGG - Intergenic
980486323 4:133461792-133461814 TGTCCTTTACAGGCCCTGGGGGG + Intergenic
980857486 4:138456601-138456623 TGTGCTGTGCAGGACATGGATGG + Intergenic
983155620 4:164344063-164344085 TGTCCTTTGCACAGCATGGATGG + Intronic
983419459 4:167499643-167499665 TTTTTTTTGCAGGACATGGATGG - Intergenic
983462341 4:168043008-168043030 TGTACTTTGCAGCACTTGGATGG + Intergenic
983499432 4:168482272-168482294 TGCCCTTACCAGGACATTGAAGG + Intronic
983809721 4:172045998-172046020 TGCTATTTGCAAGACATGGATGG - Intronic
984628016 4:182030384-182030406 TGTCTTTTGCAGGACAGGGATGG - Intergenic
984845536 4:184104994-184105016 TGGGCTTTGAAGGACAGGGAGGG + Intronic
986706049 5:10455603-10455625 TATCCTGTGCAGGACAGGGATGG - Intronic
986904207 5:12473666-12473688 TGTTCTTTGCAGGATCAGGATGG + Intergenic
989962678 5:50435250-50435272 TGTCCTTTGTAGGAAATAGACGG - Intronic
990797039 5:59555188-59555210 TGTCCTCTGCAAAACGTGGATGG + Intronic
993071139 5:83165787-83165809 TGTCCTTTGCAGGACATGGATGG - Intronic
993247684 5:85471655-85471677 TGTCCTTTGCAAAACATGGATGG + Intergenic
993568689 5:89508562-89508584 TGTCTTTTGCGGAACATGGATGG + Intergenic
993731610 5:91429334-91429356 TATCCTTTGTAGAACATGGGTGG + Intergenic
993795118 5:92257490-92257512 TGTCCTTTGCAGCATACGGATGG + Intergenic
993820605 5:92611011-92611033 TATCCTTTGCAGGACATGGATGG + Intergenic
993889903 5:93461172-93461194 TGTCCTTTGCAAGACATGGATGG + Intergenic
994543291 5:101128142-101128164 CGTCCTTTGCAGGGCATGGATGG + Intergenic
994803897 5:104418115-104418137 TGTCCTTGCAAGAACATGGATGG + Intergenic
994971426 5:106744526-106744548 TGTCTTCTATAGGACATGGATGG + Intergenic
995059044 5:107794179-107794201 TGTCCTTTGCAAAACATGGATGG + Intergenic
995155742 5:108910792-108910814 TGTCCTTTGCAGCAACTAGATGG - Intronic
995357641 5:111257835-111257857 TGTCCTTCGCAGGACATGGATGG + Intronic
995621904 5:114034868-114034890 TGTTCTTTGCAGAACATGGATGG - Intergenic
996475437 5:123914534-123914556 TGTCTTTGCCAGGACATGCATGG + Intergenic
996795853 5:127345998-127346020 TGACATTTGCAGCACCTGGATGG - Intronic
996951925 5:129137364-129137386 TGTCTTTGCAAGGACATGGATGG + Intergenic
997334629 5:133098213-133098235 TGTCTTTTGCAGCAACTGGATGG - Intronic
997363937 5:133313340-133313362 TGTCCTGGGCAGGACAAGGCAGG - Intronic
997785989 5:136714456-136714478 TGTCCTTTGCAGAAAATGGATGG - Intergenic
998046909 5:138995012-138995034 TGTCCTTTGCAGGACATGAATGG - Intronic
998415756 5:141945160-141945182 AGTCTTTTGGAGGACAGGGACGG - Exonic
998604717 5:143621948-143621970 TGTCTTTTGCAGAACATGGATGG + Intergenic
998634406 5:143937020-143937042 TGTCATTTGCACAGCATGGATGG + Intergenic
999939221 5:156522423-156522445 TGCCCTTTTCAGGACATAGATGG + Intronic
1000189600 5:158897255-158897277 TGTCCTTTGCGGGACATGGATGG + Intronic
1000588463 5:163129143-163129165 TGTCCTTTGCAGAACATGGATGG + Intergenic
1000658213 5:163907565-163907587 TGTCCTTTGCAGGAACCAGATGG - Intergenic
1000668121 5:164024329-164024351 TGTCCTTTGCAGGAACTGGATGG - Intergenic
1001178895 5:169499782-169499804 TGTCCTTTGTGCAACATGGATGG - Intergenic
1001248562 5:170125364-170125386 CATACTTTGCAGGAAATGGAGGG - Intergenic
1001448862 5:171808654-171808676 TGTCCTTTGCAGAACGTGGATGG + Intergenic
1002069790 5:176672338-176672360 TGTCCTCTGCAGGACCTGCAGGG - Intergenic
1002967748 6:1984058-1984080 TGTCCTTTGTGGGACATGGATGG + Intronic
1003076583 6:2988426-2988448 AGTCCTTTCCAGGACACTGAAGG + Intronic
1003740886 6:8937684-8937706 TGTCCTTGCAGGGACATGGATGG - Intergenic
1004247001 6:13988021-13988043 TGCCCTTAGGAGGACAGGGAAGG - Intergenic
1004534827 6:16490519-16490541 TGACCTTTGGAGGAGAAGGAAGG - Intronic
1005724727 6:28637561-28637583 TTTCCCTTCCATGACATGGAAGG + Intergenic
1005919240 6:30384100-30384122 TGTCCTTTGCGGAACATGGATGG - Intergenic
1006016437 6:31085021-31085043 TGCCCTTTGAAGGAACTGGATGG + Intergenic
1007552117 6:42738118-42738140 TGTCATTTGCAACAAATGGATGG + Intergenic
1008098064 6:47360470-47360492 TGTCTTTTGAAGGAATTGGAAGG - Intergenic
1008186252 6:48394639-48394661 TGTCCTTTGCAGGAACATGATGG - Intergenic
1008208558 6:48692786-48692808 TGTCCTTTGCAGGACATAGATGG + Intergenic
1008573987 6:52841634-52841656 TTAACTTTGCAGGATATGGAAGG + Intronic
1008670403 6:53762290-53762312 CGTCTTTTGCAGCACTTGGATGG - Intergenic
1008725670 6:54415338-54415360 TGTCCTTTGCAGGAACATGATGG - Intergenic
1009564239 6:65291597-65291619 TGTTCTTTCCATGACATGAATGG + Intronic
1010802081 6:80188165-80188187 TGTCCTTTGCAGGACATATCTGG + Intronic
1013502441 6:110766282-110766304 TGTCATTTGCAGGCCAGGCATGG + Intronic
1013563064 6:111326072-111326094 CGTCATTTGCAAAACATGGATGG - Intronic
1013896723 6:115097553-115097575 TGTCCTCTGCAGGACGTGAACGG - Intergenic
1014012775 6:116495317-116495339 TGTCATTTGCAAAACATGGATGG - Intronic
1014375300 6:120664774-120664796 TGTCCTTTGCAGGGCATGGATGG - Intergenic
1014844555 6:126259126-126259148 TGTCCTTTACAGGAACTAGATGG - Intergenic
1018140301 6:160826956-160826978 TGTTCTTTCCACGACATGAAAGG + Intergenic
1018445663 6:163855861-163855883 GGTCCTTTGCAGCCCAAGGAAGG - Intergenic
1019025116 6:168954861-168954883 TGTCATTTGCACAACATGGCTGG + Intergenic
1019098427 6:169607465-169607487 TGTCTTTTGCAGCACATGGATGG + Intronic
1021199500 7:17712350-17712372 TGCCCTTTGCGGGACATAGATGG + Intergenic
1021364247 7:19756750-19756772 GGTCTTTTGCAGGACATGGATGG - Intronic
1022747804 7:33190388-33190410 TGGCCTCTGCAGGAAATGGGAGG - Intronic
1023085859 7:36569345-36569367 TCTCCTCTGCAGGCCATGGGTGG + Intronic
1023816266 7:43952576-43952598 TGTTCTCTGCAGCACATTGAAGG + Intronic
1024782922 7:52873404-52873426 TGTCCTGTGCAGGAAACAGATGG - Intergenic
1025026061 7:55517344-55517366 TGTGGTGTGCAGGACAGGGAAGG - Intronic
1027777461 7:82484618-82484640 AGTCCTTTGGAGGACAAGGCAGG - Intergenic
1028170354 7:87588484-87588506 CGTCCTTTGCAGGGCATGGCTGG - Intronic
1028973757 7:96889465-96889487 ATTCCTTTGCAGGACATTCAAGG - Intergenic
1029160710 7:98549438-98549460 TGTCCATTGCAGGAGATGCAGGG - Intergenic
1030058973 7:105608005-105608027 TGCCCTTTGCTGGATATGGGAGG - Intronic
1030368647 7:108673121-108673143 TGGCCTGTGCAGAAAATGGATGG + Intergenic
1031562987 7:123260626-123260648 TGTCCTTCTAAGGACAAGGAAGG - Intergenic
1032081547 7:128861002-128861024 TGGCCTGTGCAGCACATGGATGG - Intergenic
1032087841 7:128893066-128893088 TGTCCTGGGAAGGACAGGGATGG - Intronic
1032739008 7:134720297-134720319 TTTCCTCTGCAGGAAATAGAAGG - Intergenic
1033737207 7:144234309-144234331 TATCCTTTGATGGACATGGATGG + Intergenic
1033745850 7:144316637-144316659 TGTCCTTTGATGGACATGGATGG - Intergenic
1033813721 7:145047766-145047788 TGTCATGTGCAAAACATGGATGG - Intergenic
1034742250 7:153487149-153487171 TGGCCTTTTCAGGATGTGGATGG - Intergenic
1034937880 7:155211437-155211459 TGGCCTTTGCAGGTCATGGTGGG - Intergenic
1035414200 7:158669072-158669094 TGTTCTTTGCAGGGAATGGATGG - Intronic
1035604332 8:919761-919783 TTTCCTCTGCAGGACACAGAAGG + Intergenic
1037268298 8:17094010-17094032 TATCTTTTGAAGGACATTGAGGG - Intronic
1039378517 8:37061834-37061856 TGACCATTGCGGGACATGTATGG - Intergenic
1040846306 8:51845290-51845312 TGTCCTCTTCAGGACATGAGAGG - Intronic
1041572043 8:59348747-59348769 TGTCCTTTGCAGAACATGGATGG + Intergenic
1042427917 8:68670555-68670577 TGAGCTTTGCAGGAAATGGCAGG - Intronic
1042630301 8:70808648-70808670 TATCCTGTGCATGACTTGGAGGG + Intergenic
1043001536 8:74766019-74766041 TGTCCTTTGCAGGAACAGGATGG + Intronic
1043290500 8:78594382-78594404 AGTCCTTTCCAGATCATGGAAGG + Intronic
1043325044 8:79039759-79039781 TGTCATTTGCAGGACATGATTGG + Intergenic
1044927455 8:97221692-97221714 TGTCCTTTTAAGGACAGGGGAGG + Intergenic
1045961008 8:107968286-107968308 TGTCATTTCCAGTGCATGGATGG + Intronic
1046418965 8:113954180-113954202 TGTCCTTAGCTGGAGATGTAAGG + Intergenic
1047219987 8:122911354-122911376 AGGCCTCTGCAGGACAGGGAGGG - Intronic
1047350307 8:124067299-124067321 TGTCCATTGCAGCAAAAGGAGGG - Intronic
1048018345 8:130517227-130517249 TTGCCTTTCCAGGGCATGGAAGG + Intergenic
1048078295 8:131097389-131097411 TGTCTTTGCAAGGACATGGATGG + Intergenic
1048109350 8:131450838-131450860 TGTCTTTTGCAGGACATGGATGG - Intergenic
1048290964 8:133181501-133181523 TGGCCTCTTCAGCACATGGATGG + Intergenic
1048325616 8:133436817-133436839 TGTCCTTTGTTGGACTTTGAAGG - Intergenic
1049086035 8:140479313-140479335 TGTCTTTTCAGGGACATGGATGG + Intergenic
1049283085 8:141760459-141760481 TGGGCTTCGCAGGCCATGGAAGG + Intergenic
1049442385 8:142615280-142615302 TGGGGTTTGGAGGACATGGAGGG + Intergenic
1049583794 8:143423908-143423930 TGACATTTGCAGGACAGGAAAGG - Intronic
1050194910 9:3071959-3071981 TGTCCTTTGCAGGGACAGGATGG - Intergenic
1050419332 9:5446935-5446957 TGTCCTTTCAAGGAAATGGTGGG + Intergenic
1050804030 9:9651545-9651567 TGTCCTTTGCAGGACATGGATGG - Intronic
1051405389 9:16732143-16732165 TTTTTTTTGCAGGAAATGGAGGG - Intronic
1052618782 9:30878104-30878126 TGTCCTTTGCAGAACATGGATGG - Intergenic
1053049232 9:34945062-34945084 TGTCATTTGGAAGACATGGGGGG - Intergenic
1055696866 9:78894401-78894423 TTACCTGTGCAAGACATGGAAGG - Intergenic
1056485337 9:87051301-87051323 TGTCTTTTGCAGAGCATGGATGG + Intergenic
1056567871 9:87790773-87790795 TGTCATTTGCGTGAAATGGATGG + Intergenic
1056844702 9:90027133-90027155 TGTGATTTGCAGGACATAGAAGG - Intergenic
1057173434 9:92977183-92977205 TGTGCTCTTCAGGACATGGTGGG + Intronic
1058234177 9:102468524-102468546 TGTCCTTTGAGGGACGTGGACGG + Intergenic
1058281074 9:103115498-103115520 TGGCCTTTGCAGGCATTGGAAGG - Intergenic
1058406463 9:104681056-104681078 TGTCATTTGCACAACATGGATGG + Intergenic
1058549369 9:106097549-106097571 TGTCCTTTGCAGGACATGGATGG + Intergenic
1059831700 9:118103394-118103416 TGTCCTTTGCAGGGCATGGGTGG + Intergenic
1061185057 9:129048231-129048253 GGTCATGAGCAGGACATGGAGGG + Intronic
1186051300 X:5598504-5598526 CGTCTTTTGCAGAACATGGATGG - Intergenic
1186115694 X:6303181-6303203 TGTCTTTTCAGGGACATGGATGG - Intergenic
1186927158 X:14346785-14346807 TGTCATTTGTAAAACATGGATGG - Intergenic
1187640241 X:21279763-21279785 TGTCTTTTGCAGGACATGAATGG - Intergenic
1187640561 X:21284263-21284285 TGTCCTTGGCAGGACGTGGATGG + Intergenic
1187724560 X:22189082-22189104 TGTCATTTGCAACACATGGATGG - Intronic
1188090620 X:25960196-25960218 TTTCTTTTGCAGGGCATGGATGG - Intergenic
1188419141 X:29975183-29975205 TGTCATTTGAACAACATGGATGG - Intergenic
1188909176 X:35824296-35824318 TGTCTTTTGTAGAATATGGATGG - Intergenic
1189926742 X:45962709-45962731 TGTACTTTGCAGCACATGCATGG + Intergenic
1190373915 X:49769975-49769997 TGTCCTTTGTGGGATATGGATGG - Intergenic
1191026762 X:55922302-55922324 TGTCCTTTGTAGGACATGGATGG + Intergenic
1191991032 X:67037251-67037273 TGTCCTTTGTGGAACTTGGATGG + Intergenic
1192275757 X:69629278-69629300 TGAGCTTTGAAGGACCTGGAGGG - Intronic
1193877172 X:86874399-86874421 TGTCCTGTGCAGGACACAGATGG + Intergenic
1194172585 X:90605807-90605829 TTTCCTTTGCAGGACATGGAAGG - Intergenic
1195207668 X:102619246-102619268 TGTCCTTTGCAGCAAATTGATGG - Intergenic
1195213602 X:102674448-102674470 TGTCCTTTCAGGGACATGGATGG - Intergenic
1195425878 X:104729809-104729831 TGTCCTTTGCAGGAACATGATGG - Intronic
1195437327 X:104860379-104860401 TGTCCTTTGCATGTCATAGGAGG + Intronic
1195890281 X:109685899-109685921 TGCCCTTTGAAGTTCATGGATGG - Intronic
1195919251 X:109966316-109966338 TTCCCTTTGCAGGGCATGGCAGG - Intergenic
1196486568 X:116217303-116217325 TGTCTTTTGCAGAACATGGATGG + Intergenic
1196643035 X:118085736-118085758 TGTCTTTTGCAGCAATTGGATGG - Intronic
1197044334 X:121977590-121977612 TGGCCTGTGCAGAAGATGGATGG + Intergenic
1197989384 X:132300841-132300863 TGTCCTTTTCAAGATGTGGAAGG - Intergenic
1198136957 X:133762806-133762828 TTTCATTTGCAGGACATCAAGGG - Intronic
1198272207 X:135065606-135065628 TGTCCTTTTTAGAACATGGTTGG - Intergenic
1198998341 X:142602866-142602888 TGTCCTTTGCAGAACATGGATGG - Intergenic
1199747623 X:150783857-150783879 TGTTCTCTGCAGTGCATGGAGGG + Intronic
1200518812 Y:4183544-4183566 TTTCCTTTGCAGGACATGGAAGG - Intergenic
1201336343 Y:12884497-12884519 TGTTTTTTGCAGCAAATGGATGG - Intergenic
1201537193 Y:15063406-15063428 TGTAGCTTGCAGGACATGGATGG - Intergenic
1202275668 Y:23117094-23117116 TGTCTTTTGCAGGAAGTGGATGG + Intergenic
1202290360 Y:23303597-23303619 TGTCTTTTGCAGGAAGTGGATGG - Intergenic
1202428660 Y:24750813-24750835 TGTCTTTTGCAGGAAGTGGATGG + Intergenic
1202442131 Y:24919276-24919298 TGTCTTTTGCAGGAAGTGGATGG - Intergenic