ID: 1090587928

View in Genome Browser
Species Human (GRCh38)
Location 11:128234336-128234358
Sequence TATACAGGAGCTATTCTAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090587928_1090587932 19 Left 1090587928 11:128234336-128234358 CCCATTAGAATAGCTCCTGTATA No data
Right 1090587932 11:128234378-128234400 GCTGTAAACTCAGACAGTGATGG No data
1090587928_1090587931 -3 Left 1090587928 11:128234336-128234358 CCCATTAGAATAGCTCCTGTATA No data
Right 1090587931 11:128234356-128234378 ATAGAATACATTGTACACACAGG No data
1090587928_1090587933 20 Left 1090587928 11:128234336-128234358 CCCATTAGAATAGCTCCTGTATA No data
Right 1090587933 11:128234379-128234401 CTGTAAACTCAGACAGTGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090587928 Original CRISPR TATACAGGAGCTATTCTAAT GGG (reversed) Intergenic
No off target data available for this crispr