ID: 1090587930

View in Genome Browser
Species Human (GRCh38)
Location 11:128234351-128234373
Sequence GTGTACAATGTATTCTATAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090587930_1090587934 17 Left 1090587930 11:128234351-128234373 CCTGTATAGAATACATTGTACAC No data
Right 1090587934 11:128234391-128234413 ACAGTGATGGGAGAATATCAAGG No data
1090587930_1090587932 4 Left 1090587930 11:128234351-128234373 CCTGTATAGAATACATTGTACAC No data
Right 1090587932 11:128234378-128234400 GCTGTAAACTCAGACAGTGATGG No data
1090587930_1090587933 5 Left 1090587930 11:128234351-128234373 CCTGTATAGAATACATTGTACAC No data
Right 1090587933 11:128234379-128234401 CTGTAAACTCAGACAGTGATGGG No data
1090587930_1090587935 22 Left 1090587930 11:128234351-128234373 CCTGTATAGAATACATTGTACAC No data
Right 1090587935 11:128234396-128234418 GATGGGAGAATATCAAGGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090587930 Original CRISPR GTGTACAATGTATTCTATAC AGG (reversed) Intergenic
No off target data available for this crispr