ID: 1090587931

View in Genome Browser
Species Human (GRCh38)
Location 11:128234356-128234378
Sequence ATAGAATACATTGTACACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090587929_1090587931 -4 Left 1090587929 11:128234337-128234359 CCATTAGAATAGCTCCTGTATAG No data
Right 1090587931 11:128234356-128234378 ATAGAATACATTGTACACACAGG No data
1090587927_1090587931 22 Left 1090587927 11:128234311-128234333 CCGGGTGCATACTTGTGGTTAAA No data
Right 1090587931 11:128234356-128234378 ATAGAATACATTGTACACACAGG No data
1090587928_1090587931 -3 Left 1090587928 11:128234336-128234358 CCCATTAGAATAGCTCCTGTATA No data
Right 1090587931 11:128234356-128234378 ATAGAATACATTGTACACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090587931 Original CRISPR ATAGAATACATTGTACACAC AGG Intergenic
No off target data available for this crispr