ID: 1090587932

View in Genome Browser
Species Human (GRCh38)
Location 11:128234378-128234400
Sequence GCTGTAAACTCAGACAGTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090587928_1090587932 19 Left 1090587928 11:128234336-128234358 CCCATTAGAATAGCTCCTGTATA No data
Right 1090587932 11:128234378-128234400 GCTGTAAACTCAGACAGTGATGG No data
1090587929_1090587932 18 Left 1090587929 11:128234337-128234359 CCATTAGAATAGCTCCTGTATAG No data
Right 1090587932 11:128234378-128234400 GCTGTAAACTCAGACAGTGATGG No data
1090587930_1090587932 4 Left 1090587930 11:128234351-128234373 CCTGTATAGAATACATTGTACAC No data
Right 1090587932 11:128234378-128234400 GCTGTAAACTCAGACAGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090587932 Original CRISPR GCTGTAAACTCAGACAGTGA TGG Intergenic
No off target data available for this crispr