ID: 1090587934

View in Genome Browser
Species Human (GRCh38)
Location 11:128234391-128234413
Sequence ACAGTGATGGGAGAATATCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090587930_1090587934 17 Left 1090587930 11:128234351-128234373 CCTGTATAGAATACATTGTACAC No data
Right 1090587934 11:128234391-128234413 ACAGTGATGGGAGAATATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090587934 Original CRISPR ACAGTGATGGGAGAATATCA AGG Intergenic
No off target data available for this crispr