ID: 1090589400

View in Genome Browser
Species Human (GRCh38)
Location 11:128249271-128249293
Sequence CAGATGTTCCAGAGGGTAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090589391_1090589400 8 Left 1090589391 11:128249240-128249262 CCCCTTCTTAGACCCTGCTCACT No data
Right 1090589400 11:128249271-128249293 CAGATGTTCCAGAGGGTAAAGGG No data
1090589392_1090589400 7 Left 1090589392 11:128249241-128249263 CCCTTCTTAGACCCTGCTCACTT No data
Right 1090589400 11:128249271-128249293 CAGATGTTCCAGAGGGTAAAGGG No data
1090589393_1090589400 6 Left 1090589393 11:128249242-128249264 CCTTCTTAGACCCTGCTCACTTT No data
Right 1090589400 11:128249271-128249293 CAGATGTTCCAGAGGGTAAAGGG No data
1090589395_1090589400 -5 Left 1090589395 11:128249253-128249275 CCTGCTCACTTTAACCTGCAGAT No data
Right 1090589400 11:128249271-128249293 CAGATGTTCCAGAGGGTAAAGGG No data
1090589394_1090589400 -4 Left 1090589394 11:128249252-128249274 CCCTGCTCACTTTAACCTGCAGA No data
Right 1090589400 11:128249271-128249293 CAGATGTTCCAGAGGGTAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090589400 Original CRISPR CAGATGTTCCAGAGGGTAAA GGG Intergenic
No off target data available for this crispr