ID: 1090592364

View in Genome Browser
Species Human (GRCh38)
Location 11:128286049-128286071
Sequence ATTAAATACAGTAACTATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090592364_1090592366 -4 Left 1090592364 11:128286049-128286071 CCTCCATAGTTACTGTATTTAAT No data
Right 1090592366 11:128286068-128286090 TAATACTTTCACCTATTGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090592364 Original CRISPR ATTAAATACAGTAACTATGG AGG (reversed) Intergenic
No off target data available for this crispr