ID: 1090593245

View in Genome Browser
Species Human (GRCh38)
Location 11:128294062-128294084
Sequence CTGTGGTCCTTGCGGTGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090593245_1090593252 -2 Left 1090593245 11:128294062-128294084 CCCTCTCACCGCAAGGACCACAG No data
Right 1090593252 11:128294083-128294105 AGAAGCCAGGGCTGGACTCCTGG No data
1090593245_1090593254 3 Left 1090593245 11:128294062-128294084 CCCTCTCACCGCAAGGACCACAG No data
Right 1090593254 11:128294088-128294110 CCAGGGCTGGACTCCTGGCCCGG No data
1090593245_1090593258 21 Left 1090593245 11:128294062-128294084 CCCTCTCACCGCAAGGACCACAG No data
Right 1090593258 11:128294106-128294128 CCCGGGAAGCTCCAGTCCCATGG No data
1090593245_1090593255 4 Left 1090593245 11:128294062-128294084 CCCTCTCACCGCAAGGACCACAG No data
Right 1090593255 11:128294089-128294111 CAGGGCTGGACTCCTGGCCCGGG No data
1090593245_1090593250 -10 Left 1090593245 11:128294062-128294084 CCCTCTCACCGCAAGGACCACAG No data
Right 1090593250 11:128294075-128294097 AGGACCACAGAAGCCAGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090593245 Original CRISPR CTGTGGTCCTTGCGGTGAGA GGG (reversed) Intergenic
No off target data available for this crispr