ID: 1090593680

View in Genome Browser
Species Human (GRCh38)
Location 11:128297628-128297650
Sequence ATGCAAGATGGTTCTCCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090593675_1090593680 -9 Left 1090593675 11:128297614-128297636 CCATGCAAGTATTTATGCAAGAT No data
Right 1090593680 11:128297628-128297650 ATGCAAGATGGTTCTCCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090593680 Original CRISPR ATGCAAGATGGTTCTCCTGG GGG Intergenic
No off target data available for this crispr