ID: 1090595701

View in Genome Browser
Species Human (GRCh38)
Location 11:128319013-128319035
Sequence ATCGCATACCACTTCCTGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090595701_1090595707 29 Left 1090595701 11:128319013-128319035 CCCTTCAGGAAGTGGTATGCGAT No data
Right 1090595707 11:128319065-128319087 TCTGAGTCAGGGCTACCACAAGG No data
1090595701_1090595703 -4 Left 1090595701 11:128319013-128319035 CCCTTCAGGAAGTGGTATGCGAT No data
Right 1090595703 11:128319032-128319054 CGATGATGTACTATAGTAGCTGG No data
1090595701_1090595705 18 Left 1090595701 11:128319013-128319035 CCCTTCAGGAAGTGGTATGCGAT No data
Right 1090595705 11:128319054-128319076 GTATGTTTCCTTCTGAGTCAGGG No data
1090595701_1090595704 17 Left 1090595701 11:128319013-128319035 CCCTTCAGGAAGTGGTATGCGAT No data
Right 1090595704 11:128319053-128319075 GGTATGTTTCCTTCTGAGTCAGG No data
1090595701_1090595708 30 Left 1090595701 11:128319013-128319035 CCCTTCAGGAAGTGGTATGCGAT No data
Right 1090595708 11:128319066-128319088 CTGAGTCAGGGCTACCACAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090595701 Original CRISPR ATCGCATACCACTTCCTGAA GGG (reversed) Intergenic
No off target data available for this crispr