ID: 1090599628

View in Genome Browser
Species Human (GRCh38)
Location 11:128356990-128357012
Sequence TGGAATCTTCAGGATGGGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090599628_1090599638 15 Left 1090599628 11:128356990-128357012 CCCATCCCATCCTGAAGATTCCA No data
Right 1090599638 11:128357028-128357050 GCCCAATAACCAGAGTGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090599628 Original CRISPR TGGAATCTTCAGGATGGGAT GGG (reversed) Intergenic
No off target data available for this crispr