ID: 1090601186

View in Genome Browser
Species Human (GRCh38)
Location 11:128373542-128373564
Sequence CAAGACAGTGAAACATTATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090601186_1090601189 -8 Left 1090601186 11:128373542-128373564 CCAAATAATGTTTCACTGTCTTG No data
Right 1090601189 11:128373557-128373579 CTGTCTTGAGGTGGAGAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090601186 Original CRISPR CAAGACAGTGAAACATTATT TGG (reversed) Intergenic
No off target data available for this crispr