ID: 1090606717

View in Genome Browser
Species Human (GRCh38)
Location 11:128429292-128429314
Sequence AGAATGGCAGGCCCTGCACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090606710_1090606717 21 Left 1090606710 11:128429248-128429270 CCTCCAAAGCACAGGATTTGTTA No data
Right 1090606717 11:128429292-128429314 AGAATGGCAGGCCCTGCACAGGG No data
1090606709_1090606717 24 Left 1090606709 11:128429245-128429267 CCTCCTCCAAAGCACAGGATTTG No data
Right 1090606717 11:128429292-128429314 AGAATGGCAGGCCCTGCACAGGG No data
1090606711_1090606717 18 Left 1090606711 11:128429251-128429273 CCAAAGCACAGGATTTGTTAATA No data
Right 1090606717 11:128429292-128429314 AGAATGGCAGGCCCTGCACAGGG No data
1090606708_1090606717 25 Left 1090606708 11:128429244-128429266 CCCTCCTCCAAAGCACAGGATTT No data
Right 1090606717 11:128429292-128429314 AGAATGGCAGGCCCTGCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090606717 Original CRISPR AGAATGGCAGGCCCTGCACA GGG Intergenic
No off target data available for this crispr