ID: 1090616900

View in Genome Browser
Species Human (GRCh38)
Location 11:128522720-128522742
Sequence AAAACTATGCTGCTACTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 102}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090616900_1090616904 21 Left 1090616900 11:128522720-128522742 CCTCCCAGTAGCAGCATAGTTTT 0: 1
1: 0
2: 0
3: 9
4: 102
Right 1090616904 11:128522764-128522786 ATTCACAAAGACTGACACACAGG 0: 1
1: 0
2: 0
3: 21
4: 283
1090616900_1090616905 29 Left 1090616900 11:128522720-128522742 CCTCCCAGTAGCAGCATAGTTTT 0: 1
1: 0
2: 0
3: 9
4: 102
Right 1090616905 11:128522772-128522794 AGACTGACACACAGGACGTGAGG 0: 1
1: 0
2: 0
3: 4
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090616900 Original CRISPR AAAACTATGCTGCTACTGGG AGG (reversed) Intronic
901322409 1:8347906-8347928 AACACTGTGCTGCTGCAGGGAGG + Intergenic
904194567 1:28775413-28775435 AAAACCAGGCTGCGACGGGGTGG - Intergenic
905294864 1:36947750-36947772 AAAACTATCCTGCTTCATGGGGG - Intronic
906178840 1:43800507-43800529 GAAACTGTGCTGCTAATGTGAGG + Intronic
906249950 1:44303251-44303273 AGAACTATGCTGCTAATGTCAGG - Intronic
906456723 1:46003623-46003645 AAAATTAGCCTGCTACAGGGTGG - Intronic
906845629 1:49188566-49188588 AGAACTATTCAGCTACTAGGGGG - Intronic
910082771 1:83361135-83361157 AAATCAATGCTGCTACCTGGGGG + Intergenic
923645156 1:235812775-235812797 AAAACCATGGTGCTTCTTGGGGG - Intronic
924110474 1:240693977-240693999 GAAACTATGCTGGGACTGGCAGG + Intergenic
1065047869 10:21760022-21760044 AAAACTGTGCTGCCTCTGGAAGG + Intronic
1066136985 10:32458136-32458158 AAAACTATGAAACTACTGGAAGG - Intronic
1069213752 10:65793821-65793843 AAAAATATGAAGCTTCTGGGAGG + Intergenic
1071807451 10:89139643-89139665 AAAAATATGCTCCGACTAGGGGG + Intergenic
1079434861 11:20437883-20437905 AAAACTATGCTGCTGCCGGCCGG - Intronic
1084157454 11:67322101-67322123 AAAACTGTTCTCCCACTGGGTGG + Intronic
1084664878 11:70570944-70570966 ATAACTATGCTGCATCTTGGGGG + Intronic
1084746754 11:71175358-71175380 AAACCAAGGCTGCTGCTGGGTGG + Intronic
1088310676 11:108457174-108457196 AAAAACATGATGATACTGGGAGG + Intronic
1090616900 11:128522720-128522742 AAAACTATGCTGCTACTGGGAGG - Intronic
1093396845 12:18693322-18693344 AGACCTATGCAGATACTGGGGGG + Intronic
1093859507 12:24146165-24146187 AAATATATGCTGCTACTGTTGGG - Intergenic
1094699385 12:32854017-32854039 ATATATATACTGCTACTGGGAGG - Intronic
1097178580 12:57157955-57157977 AAAGTCACGCTGCTACTGGGTGG + Intronic
1105858086 13:24388863-24388885 AGAACAATGCAGCCACTGGGTGG + Intergenic
1113424803 13:110199234-110199256 AAAGCTCTGCTGCTTCTGTGAGG + Intronic
1114728380 14:24963927-24963949 CACACTAAGATGCTACTGGGTGG - Intronic
1115492277 14:33968947-33968969 AAATTGATGCTGCTGCTGGGAGG - Intronic
1115513239 14:34158972-34158994 AAAATTCTGCTGGTACTGAGTGG + Intronic
1120210444 14:81628732-81628754 AAAAGTAGGAAGCTACTGGGAGG + Intergenic
1124450854 15:29789178-29789200 TATATTATACTGCTACTGGGCGG + Intronic
1125681053 15:41530375-41530397 GCAACTATACTGCTCCTGGGGGG + Intronic
1126383223 15:48068951-48068973 AAAACGCTCCTGCTTCTGGGTGG + Intergenic
1127174606 15:56340106-56340128 AAAACAATGCTGCTTCTAGGGGG - Intronic
1129614381 15:77086737-77086759 AAAAATATACTGCTATTGGGGGG + Intergenic
1129772444 15:78211318-78211340 AAAATTATGCTCCTTCTGGAAGG + Intronic
1131423583 15:92327234-92327256 AGAACTATGCTGCTGCATGGAGG - Intergenic
1139872450 16:70118446-70118468 AAAACTGTCCTGCTCCTTGGTGG - Intronic
1140363322 16:74362853-74362875 AAAACTGTCCTGCTCCTTGGTGG + Intergenic
1144734305 17:17546394-17546416 AAAGCCCTGCTGCTCCTGGGAGG - Intronic
1149542787 17:57480468-57480490 AAAACTCTCCTGCTGCTGGTTGG - Intronic
1150875067 17:68961776-68961798 AAATGTATGCTGCACCTGGGAGG + Intergenic
1160928760 19:1559902-1559924 AACAGAATGCTGCGACTGGGAGG - Intronic
1164724361 19:30455950-30455972 AAAACTTTGCTGATCCTGGTGGG - Intronic
1164759360 19:30717323-30717345 CAAACTATGCTGCTTCAGGGTGG - Intergenic
1164875967 19:31689272-31689294 AAAAAACTGCAGCTACTGGGGGG + Intergenic
925226526 2:2188296-2188318 AAAACGATTCTGCTATTTGGTGG + Intronic
932903096 2:75722841-75722863 AAAAATATTTTGCTAATGGGAGG - Intergenic
945706257 2:213236643-213236665 AAAACTATGTTTCTATTGGAAGG + Intergenic
947069280 2:226268685-226268707 GAAATTATCTTGCTACTGGGGGG + Intergenic
1172821560 20:37739621-37739643 AAAGAGATGCTGCTGCTGGGGGG - Intronic
1175662878 20:60832127-60832149 AAAACAATGGTGGTACTGGTGGG + Intergenic
1179537887 21:42063924-42063946 TAAACTCTGCTGAAACTGGGGGG - Intronic
1181847811 22:25726695-25726717 AAAACTCTCCTGTTACAGGGGGG - Exonic
1182404029 22:30108831-30108853 AAAACTTTACTGCCACTGTGTGG - Intronic
1184814075 22:46857300-46857322 AAATCTCTGCTGCCCCTGGGTGG + Intronic
949601282 3:5600716-5600738 ATAACAATACTCCTACTGGGTGG - Intergenic
951345967 3:21547265-21547287 AAAACTATGCTTTTGCTGGCAGG - Intronic
954496793 3:50972168-50972190 GCAGGTATGCTGCTACTGGGAGG + Intronic
958697018 3:97540615-97540637 TAAACTATGCTGCTAATTGTCGG + Intronic
964478869 3:157122383-157122405 AAATCTGTGCTGCTACTTGAAGG - Intergenic
967536848 3:190614719-190614741 AAAACAATGCAGCTACTGATGGG + Intronic
970282992 4:14478696-14478718 AAAACTGTGGTGCTACAGGGAGG - Intergenic
970902046 4:21171406-21171428 AAAACTGTGCTGATCTTGGGTGG + Intronic
976706216 4:88022292-88022314 ATAACTCTGCTGATACTGTGAGG - Intronic
977634376 4:99280173-99280195 AACCCTATGCTGCTACTGACTGG - Exonic
977637054 4:99311550-99311572 AACCCTATGCTGCTACTGACTGG - Exonic
977639499 4:99340604-99340626 AACCCTATGCTGCTACTGACTGG - Exonic
978714293 4:111823178-111823200 AAAAGTTTGCTGCCACTGGCTGG - Intergenic
979535831 4:121819539-121819561 CAAACTCTGCTACTTCTGGGGGG + Exonic
982333706 4:154210555-154210577 AAAACTCTGCTGCTCTTGTGGGG + Intergenic
984082787 4:175269583-175269605 TAAACTTTGCTGCTTTTGGGGGG + Intergenic
987717265 5:21587876-21587898 AAAACTGTGCTGTTACCAGGTGG + Intergenic
989117284 5:37967404-37967426 AACTTTATGCTGCTACTGGTTGG + Intergenic
992867619 5:80973558-80973580 TAAGCTTTGCTGCTACTTGGAGG + Intronic
995849378 5:116529018-116529040 AAGGCTCTGCTGGTACTGGGTGG + Intronic
998256713 5:140594067-140594089 CAATTTATGCAGCTACTGGGAGG - Intergenic
1000124334 5:158228542-158228564 AAAAATAATCTCCTACTGGGAGG + Intergenic
1002399566 5:178984028-178984050 AAAAAGCTGCTGCTTCTGGGTGG - Intronic
1002552742 5:180008425-180008447 AAAAATATTCTGCTGTTGGGTGG - Intronic
1007297378 6:40835427-40835449 AAAACTATGCTGTCACTGGAGGG + Intergenic
1009889714 6:69666016-69666038 AAATGTATGATACTACTGGGTGG + Intergenic
1014876330 6:126665159-126665181 AAAACTACACACCTACTGGGTGG - Intergenic
1015814136 6:137190911-137190933 CAAAATATGCTGATTCTGGGTGG + Intergenic
1017531897 6:155301412-155301434 AAAACATTTCTGCTACTGGTTGG - Intronic
1018875917 6:167822457-167822479 TAAACTAAGATGCTACTGGAAGG - Intergenic
1019849051 7:3536360-3536382 AAAATTATTCTGCTAGTGGCCGG - Intronic
1021573681 7:22088960-22088982 AAAACTGTGCTGCTGGTTGGAGG - Intergenic
1029863250 7:103598141-103598163 AAGACTATACTGCTACTGATAGG + Intronic
1033148215 7:138889972-138889994 AAACCTATGCTGCATGTGGGAGG - Intronic
1033638949 7:143242054-143242076 AAAACCCTGGTGCTACTGGCAGG + Intergenic
1033733537 7:144200718-144200740 AAAAATATTCTGTTACTGGCCGG + Intergenic
1033749513 7:144350255-144350277 AAAAATATTCTGTTACTGGCCGG - Intergenic
1034103816 7:148473588-148473610 AAAATTATTCTGCTACAGGTGGG - Intergenic
1035110497 7:156477888-156477910 AAAACTATGAAACTACTGGAAGG + Intergenic
1036805743 8:11831911-11831933 AAATCTATGATTCTACTGAGGGG - Intronic
1037272547 8:17145726-17145748 AAAACCATCCTCCTACTGGGTGG - Intergenic
1038660294 8:29491372-29491394 GAAACTATGCAGGTGCTGGGAGG - Intergenic
1039699345 8:39946317-39946339 AAAACTCTGCTCCCACTGGGCGG + Intronic
1041354521 8:56986267-56986289 AAAACATTGCTGTTACTGGATGG + Intronic
1043563887 8:81526416-81526438 AAAAATGTGATGGTACTGGGAGG - Intronic
1043671070 8:82885112-82885134 TATATTATGCTGCTATTGGGTGG - Intergenic
1044768564 8:95604495-95604517 ATATCTATGTTGCTCCTGGGGGG + Intergenic
1056709148 9:88976678-88976700 AAAACTATGTTTCTACCGCGTGG + Intergenic
1058665200 9:107307582-107307604 AAAACTATGCAGTGACTGGAAGG + Intronic
1189687249 X:43577420-43577442 AAAAATATTCTACTAGTGGGTGG - Intergenic
1190542397 X:51491178-51491200 AAAACTGTGCAGCTACTGTGTGG + Exonic
1190628379 X:52359804-52359826 TAATCTATGATGCTGCTGGGTGG - Intergenic
1192300770 X:69899456-69899478 AAAACCATGTTGCAAATGGGAGG + Intronic
1193038514 X:76979343-76979365 GTCACTCTGCTGCTACTGGGGGG - Intergenic
1198314012 X:135448922-135448944 AAAACTTTGCAGTTACTGGCAGG + Intergenic
1198691578 X:139290650-139290672 AAAATTATGCTGCTGCTTAGGGG + Intergenic