ID: 1090619464

View in Genome Browser
Species Human (GRCh38)
Location 11:128548670-128548692
Sequence GAAGGGCGAGGTTCGGGCCG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 146}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090619445_1090619464 29 Left 1090619445 11:128548618-128548640 CCAACCGTCTATTTCTTAAGCCC 0: 1
1: 0
2: 0
3: 6
4: 158
Right 1090619464 11:128548670-128548692 GAAGGGCGAGGTTCGGGCCGAGG 0: 1
1: 0
2: 1
3: 10
4: 146
1090619453_1090619464 7 Left 1090619453 11:128548640-128548662 CCGCTTGGGGCCCAGGCGCTGCC 0: 1
1: 0
2: 4
3: 22
4: 263
Right 1090619464 11:128548670-128548692 GAAGGGCGAGGTTCGGGCCGAGG 0: 1
1: 0
2: 1
3: 10
4: 146
1090619451_1090619464 9 Left 1090619451 11:128548638-128548660 CCCCGCTTGGGGCCCAGGCGCTG 0: 1
1: 0
2: 0
3: 17
4: 165
Right 1090619464 11:128548670-128548692 GAAGGGCGAGGTTCGGGCCGAGG 0: 1
1: 0
2: 1
3: 10
4: 146
1090619456_1090619464 -4 Left 1090619456 11:128548651-128548673 CCAGGCGCTGCCACAGGCCGAAG 0: 1
1: 0
2: 0
3: 8
4: 146
Right 1090619464 11:128548670-128548692 GAAGGGCGAGGTTCGGGCCGAGG 0: 1
1: 0
2: 1
3: 10
4: 146
1090619455_1090619464 -3 Left 1090619455 11:128548650-128548672 CCCAGGCGCTGCCACAGGCCGAA 0: 1
1: 0
2: 1
3: 2
4: 96
Right 1090619464 11:128548670-128548692 GAAGGGCGAGGTTCGGGCCGAGG 0: 1
1: 0
2: 1
3: 10
4: 146
1090619446_1090619464 25 Left 1090619446 11:128548622-128548644 CCGTCTATTTCTTAAGCCCCGCT 0: 1
1: 0
2: 0
3: 3
4: 115
Right 1090619464 11:128548670-128548692 GAAGGGCGAGGTTCGGGCCGAGG 0: 1
1: 0
2: 1
3: 10
4: 146
1090619452_1090619464 8 Left 1090619452 11:128548639-128548661 CCCGCTTGGGGCCCAGGCGCTGC 0: 1
1: 0
2: 2
3: 28
4: 314
Right 1090619464 11:128548670-128548692 GAAGGGCGAGGTTCGGGCCGAGG 0: 1
1: 0
2: 1
3: 10
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090619464 Original CRISPR GAAGGGCGAGGTTCGGGCCG AGG Intronic
900357713 1:2272819-2272841 GGAGGGGGAGGCTCGGGGCGTGG - Intronic
900357723 1:2272841-2272863 GGAGGGCGAGGCTCGGGGCGTGG - Intronic
900609959 1:3540451-3540473 GAAGGCCCAGGTTCAGGCCTGGG + Intronic
900661582 1:3787106-3787128 GAAGGGCAAGGGCCGTGCCGAGG - Exonic
900713714 1:4130686-4130708 GAAGGGCCAGGTTGGGTCCATGG + Intergenic
903263284 1:22142671-22142693 GCAGAGGGACGTTCGGGCCGTGG + Intronic
905221446 1:36450645-36450667 AAAGGGCGAGGGCCGGGCCAGGG + Intergenic
906114739 1:43349087-43349109 GAGGGGCGAGGCGCGGGGCGCGG + Intronic
906150132 1:43582801-43582823 GGAGGCCGAGGGTGGGGCCGGGG - Intronic
906468427 1:46105759-46105781 GAAGGGGGAGGTGGGGGCAGAGG + Intronic
906660478 1:47578217-47578239 GCAGGGCGAGGGTGGGGCAGGGG - Intergenic
908132085 1:61083468-61083490 GAGGGGCGCTGTCCGGGCCGGGG - Intronic
910825717 1:91404896-91404918 GAAGGGAGAGGTTGGGGGCTTGG - Intergenic
913112859 1:115671717-115671739 GCATGGCGAGGTTTGTGCCGCGG + Intronic
919743809 1:200996183-200996205 GAAGGCCAAGGTAGGGGCCGAGG - Exonic
920261902 1:204693996-204694018 CAAGGGAGAGGTTCGGGTCTGGG - Intergenic
922784872 1:228277854-228277876 GAAGGGTGAGGTGGGGGCTGAGG + Exonic
924289651 1:242524506-242524528 GGAGGGCGAGGTGCGGGCGGGGG + Exonic
1064357308 10:14631586-14631608 GCAGGGCTAGGTTTGGGGCGGGG - Intronic
1067293298 10:44959727-44959749 GAGGGGCGAGGGGCGGGGCGAGG + Intronic
1072724271 10:97801798-97801820 GAAGGGGGAGGATGGGGCTGTGG + Intergenic
1074087687 10:110221046-110221068 GAAGGGTGAGGTTGGGCCCAAGG + Intronic
1074378783 10:112961258-112961280 GAAGGCCGAGGTTGGGGGGGGGG - Intronic
1074606161 10:114969770-114969792 GAAGGGGGAGGCTGGGGCGGGGG + Intronic
1076613750 10:131743112-131743134 GGAGGGCAAGGGTGGGGCCGTGG - Intergenic
1077105855 11:842396-842418 GAGGGGTGAGGCGCGGGCCGGGG - Exonic
1077201437 11:1309435-1309457 GCCGGGCGAGGGTCGGGCGGGGG - Intronic
1077601756 11:3579663-3579685 GAAGGGAGAGGTCCTGGTCGGGG - Intergenic
1081698515 11:45136629-45136651 GAAGGCCGAGGTGAGGGCTGCGG + Intronic
1083648402 11:64186273-64186295 GAAGGGGGAGGGGCGGGCTGAGG + Intronic
1083729325 11:64644392-64644414 GGAGGGAGAGGTTGGGGCTGGGG - Intronic
1083879298 11:65540227-65540249 GATGGGTGAGGCCCGGGCCGGGG - Exonic
1084086267 11:66856772-66856794 GCAGAGTGAGGTTCGCGCCGCGG + Intronic
1084257660 11:67954210-67954232 GAAGGGAGAGGTCCTGGTCGGGG - Intergenic
1084640592 11:70423648-70423670 GAGGGGCGAGGTGTGGGCCTGGG + Intronic
1089869601 11:121660393-121660415 AAAGGGCAAGGTTCGGGGGGGGG + Intergenic
1089911013 11:122100846-122100868 GAAGGGCTGGGTGCGGGCTGGGG + Intergenic
1090619464 11:128548670-128548692 GAAGGGCGAGGTTCGGGCCGAGG + Intronic
1091236315 11:134024682-134024704 GGGGGGCGAGGGTCGGCCCGAGG - Intergenic
1091755153 12:3046432-3046454 AAAGGGAGAGGTTCAGGCAGGGG + Intergenic
1092427897 12:8389032-8389054 GAAGGGAGAGGTCCTGGTCGGGG - Intergenic
1092429165 12:8396019-8396041 GAAGGGAGAGGTCCTGGTCGGGG - Intergenic
1096521733 12:52188348-52188370 GTAGGGCCAGGTTGGGGCTGAGG + Intronic
1103786393 12:123436342-123436364 GAGGGACGAGGTTGGGCCCGAGG - Exonic
1121617058 14:95320089-95320111 GAGGGGCGAGGGGCGGGGCGGGG + Intergenic
1122267814 14:100554853-100554875 GAATGGCGAGGCTGGGGCTGTGG - Intronic
1122840906 14:104462089-104462111 GAAGGGCGAGCTGCGGAGCGCGG + Intergenic
1128482739 15:68054225-68054247 GAAGGTGGAGGGGCGGGCCGGGG + Exonic
1129205047 15:74032592-74032614 GAAGGCCCAGGTTCAGGCCCTGG + Exonic
1131446325 15:92500628-92500650 GAAGGGCGAGGTCGGGGCTCTGG - Exonic
1132055934 15:98650015-98650037 AAGGGGCGAGGTGCGGGTCGCGG - Intronic
1132552790 16:560278-560300 GGGGCGCGGGGTTCGGGCCGGGG + Intergenic
1132559938 16:589052-589074 GAAGAGCGCGGTCCGGGCCCTGG + Intergenic
1132719750 16:1309804-1309826 GCGGGGCGGGGGTCGGGCCGAGG + Intronic
1134275342 16:12770884-12770906 GAAGGGGGAGGGGCGGGGCGGGG + Intronic
1136382279 16:29901201-29901223 GAAGAGCAAGGTGAGGGCCGAGG - Exonic
1139475270 16:67199770-67199792 GAAGGCCGAGCTTGGGGCTGGGG - Intronic
1139784962 16:69385575-69385597 GCAGGGTGAGGGCCGGGCCGGGG - Exonic
1140410528 16:74738143-74738165 GAAGGGCGAGGGCTGGGCCCTGG - Intronic
1141946113 16:87311095-87311117 GAAGAGTGAGGTGGGGGCCGGGG - Intronic
1141989970 16:87603824-87603846 GAAGGGCCAGGCTGGGCCCGCGG + Intronic
1142183864 16:88685419-88685441 GAAGGGCGCTGTTGGGGCTGTGG - Intronic
1142743757 17:1944862-1944884 CAGGGGCGAGGTTGGGGCAGAGG - Intronic
1146264001 17:31439064-31439086 GAAGGGTGAGGTTCAGGCAGTGG - Intronic
1147723915 17:42554821-42554843 AAAGGCCGAGGCTGGGGCCGAGG + Exonic
1149445176 17:56707809-56707831 GAAGGGGGAGGGACGGGCGGGGG + Intergenic
1150509151 17:65730769-65730791 GAAGGGCTTGGTTGGGGGCGGGG - Intronic
1151580189 17:74973021-74973043 GAAGGGTGAGGACCGGGGCGGGG - Intronic
1152501106 17:80709575-80709597 GAAGGGCGGGGTCCCGGCAGGGG - Intronic
1152927006 17:83092011-83092033 GCAGGGCGAGGGCTGGGCCGAGG + Intronic
1203171024 17_GL000205v2_random:148031-148053 GAAGGGCCATGTTTGGGCAGTGG + Intergenic
1154324517 18:13380230-13380252 GAATGGCCTGGTTCGGGCCCTGG + Intronic
1160163949 18:76494839-76494861 GAGGGGCGGGGTGGGGGCCGGGG - Intronic
1160720695 19:595824-595846 TAAGGGAGAGCCTCGGGCCGGGG - Intronic
1160838857 19:1137290-1137312 GTGGGGGGAGGCTCGGGCCGGGG + Intronic
1160838870 19:1137317-1137339 GTGGGGGGAGGCTCGGGCCGGGG + Intronic
1160838883 19:1137344-1137366 GTGGGGGGAGGCTCGGGCCGGGG + Intronic
1160838895 19:1137371-1137393 GTGGGGGGAGGCTCGGGCCGGGG + Intronic
1160838957 19:1137527-1137549 GTGGGGGGAGGTTCGGGCTGGGG + Intronic
1160839099 19:1137858-1137880 GTGGGGGGAGGTTCGGGCTGGGG + Intronic
1161283982 19:3459531-3459553 GAAGGGGGAGGTTTGGGCTCTGG - Intronic
1161303952 19:3556855-3556877 GACAGGGGAGGTTCGGGCCAGGG + Intronic
1162145664 19:8611084-8611106 GAAGGGAGAGGTTGGGGGAGGGG + Intergenic
1165763474 19:38336081-38336103 GAAGGGCGAAGGGCGGGGCGGGG + Intronic
1166330712 19:42076510-42076532 GAGGGGCGGGGCTCGGGCTGAGG + Intronic
1168064172 19:53909793-53909815 GGAAGGCGAGGTACGGGGCGAGG + Intronic
1168113378 19:54207527-54207549 GAAGGGCCAGGGTGGGGCTGGGG + Exonic
931253748 2:60553779-60553801 GGAGGGGGAGGTGCGGGGCGGGG + Intergenic
944634528 2:201661852-201661874 GAAGGCTGAGGTTGAGGCCGGGG - Intronic
945119632 2:206443976-206443998 GCAGGGCGGCGTGCGGGCCGGGG - Exonic
949047242 2:241877701-241877723 GAAGGGCGGGGTAGGGGCCCTGG - Intergenic
1173597923 20:44271782-44271804 GAGGGGCGTGGTTCAGGCAGGGG + Intronic
1175633386 20:60560557-60560579 GAAAGGCGAGGTTGGAGCAGAGG + Intergenic
1176169254 20:63689621-63689643 GAAGGGCCAGGGTGGGGCTGGGG + Exonic
1176327008 21:5509862-5509884 GAAGGGCCATGTTTGGGCAGTGG + Intergenic
1176400749 21:6311089-6311111 GAAGGGCCATGTTTGGGCAGTGG - Intergenic
1176436408 21:6678015-6678037 GAAGGGCCATGTTTGGGCAGTGG + Intergenic
1176460670 21:7005085-7005107 GAAGGGCCATGTTTGGGCAGTGG + Intergenic
1176484231 21:7386863-7386885 GAAGGGCCATGTTTGGGCAGTGG + Intergenic
1179499078 21:41795550-41795572 GAAGGGCCAGGTTTGGGGCCGGG + Intergenic
1181162749 22:20967574-20967596 GGCGGCCGAGGTTCGGGCAGAGG + Intronic
1182300601 22:29334818-29334840 GAAGGCCCAGATTCTGGCCGAGG - Intronic
1183492449 22:38123736-38123758 GAAGGGAGAGGTTCATGCCAGGG + Intronic
1183909010 22:41064588-41064610 GAAGGGCCAGGGTGGGGCTGGGG + Intergenic
1184363604 22:44033995-44034017 AAAGGGGGAGGTCCGGGGCGGGG + Intronic
1185333276 22:50261038-50261060 GCCGGGCGGGGGTCGGGCCGTGG - Intronic
950785181 3:15428159-15428181 TAGGGGCGAGGTTGGGGGCGGGG - Intronic
956659501 3:71583858-71583880 GGAGGTAGAGGGTCGGGCCGGGG - Intronic
957072593 3:75578698-75578720 GAAGGGAGAGGTCCTGGTCGGGG - Intergenic
968550684 4:1222195-1222217 CAAGGGCGAGGGGCGGGGCGGGG + Intronic
969016194 4:4106033-4106055 GAAGGGAGAGGTCCTGGTCGGGG - Intergenic
969422108 4:7103464-7103486 GAAGGGCGGGGTTCGGGGCAAGG - Intergenic
969737756 4:9002315-9002337 GAAGGGAGAGGTCCTGGTCGCGG + Intergenic
969738837 4:9009553-9009575 GAAGGGGGAAGTGCGGGCCCAGG + Intergenic
973292427 4:48483648-48483670 CGAGGGCGAGGTCCGTGCCGGGG - Exonic
975405199 4:73981350-73981372 GAAGGGGGAGGGTTGGGCAGAGG + Intronic
978761301 4:112358105-112358127 GAAGGGCCAGGTTGGGGCTGGGG + Intronic
981045104 4:140257481-140257503 TAAGGGGGAGGTTTGGGCCTAGG + Intronic
981423733 4:144580741-144580763 GAAAGGCGGGGTTCCTGCCGAGG + Intergenic
982281242 4:153684824-153684846 GAAGCGGGAGGGCCGGGCCGGGG - Intergenic
982765024 4:159336311-159336333 GAAGGGTGAGGTTAGGGCCAGGG - Intronic
985537640 5:473777-473799 GCAGGGAGAGGGGCGGGCCGTGG - Intronic
990286953 5:54310181-54310203 GCAGGGCGAGGGTCGCGCTGGGG - Intronic
992113697 5:73519570-73519592 GAAGGGTGAGGTTGGGACAGTGG + Intergenic
996466668 5:123810537-123810559 AAAGGGTGAGGTTAGGGCCGGGG + Intergenic
996567259 5:124892741-124892763 GCAGGGCTAGGCTCTGGCCGGGG - Intergenic
998119268 5:139562132-139562154 GGATGGCGGGGTTGGGGCCGAGG + Intronic
999382908 5:151134355-151134377 GAGGGGAGAGGTTGGGGCCCTGG - Intronic
1004044355 6:12011552-12011574 GAGGGGCGGGGTTAGGGACGCGG - Intronic
1006472668 6:34237369-34237391 GAGGGGCGACGTGCGGGCGGGGG - Intronic
1010392068 6:75349345-75349367 GAGGGGTGAGGTTGGGGGCGGGG - Intronic
1013422235 6:109977883-109977905 GAAGGGGGAGGTTGGGACAGGGG - Intergenic
1013472457 6:110476972-110476994 CAAGGGCTAGGCTCGGTCCGGGG + Intergenic
1019828252 7:3301402-3301424 GAGGGGCGCGGCGCGGGCCGGGG - Intergenic
1020408507 7:7864987-7865009 GAAGGGCGAGGTCCCGGAAGGGG + Intronic
1023831996 7:44044832-44044854 GACGGGCCAGGGTCGGGCCAGGG + Intronic
1027421359 7:78020185-78020207 CACGGACGAGGTTCGGGGCGTGG - Intronic
1029074860 7:97927678-97927700 GAAGGGAGAGGTTCTGGTCGGGG - Intergenic
1029423568 7:100483834-100483856 GAAGGGTGGGTTTGGGGCCGGGG + Intergenic
1032252982 7:130273474-130273496 GAAGGGGGAGGTGCGGGCCGGGG + Intronic
1035553198 8:545163-545185 GAAGGGCGAGGGTCTCGCCGGGG - Intronic
1036257946 8:7220452-7220474 GAAGGGAGAGGTCCTGGTCGGGG - Intergenic
1036259195 8:7227450-7227472 GAAGGGAGAGGTCCTGGTCGGGG - Intergenic
1036307432 8:7612071-7612093 GAAGGGAGAGGTCCTGGTCGGGG + Intergenic
1036311248 8:7686045-7686067 GAAGGGAGAGGTCCTGGTCGGGG - Intergenic
1036358276 8:8060055-8060077 GAAGGGAGAGGTCCTGGTCGGGG + Intergenic
1036892674 8:12606888-12606910 GAAGGGAGAGGTCCTGGTCGGGG - Intergenic
1039903224 8:41767507-41767529 GCAGGGCCAGGGCCGGGCCGGGG - Intronic
1040065455 8:43140825-43140847 GGAGGGGGCGGTTCGGACCGCGG + Intronic
1041108910 8:54467339-54467361 GAAGGGCGAGGCGCCGGCCGGGG + Intergenic
1049879362 8:145051907-145051929 GAAGAGCGAGGGTCAGGGCGCGG - Intergenic
1050113803 9:2242545-2242567 GAAGGGCGAGGACCGGGCGAAGG + Intergenic
1057819754 9:98321913-98321935 GAAGGACGAGTTTCAGGCCAGGG - Intronic
1059102451 9:111483701-111483723 GAAGGGCGACGCTCGCGACGCGG - Intronic
1060514647 9:124258135-124258157 GAAGGGCGGGGGCCGGGCGGCGG + Intronic
1061379384 9:130244895-130244917 GGAGGGTGAGGATGGGGCCGAGG - Intergenic
1195691337 X:107628391-107628413 GAAGGGCGGGGTTTGGTCCTCGG - Intergenic
1201191042 Y:11441627-11441649 GTAGGGTGAGGTTAGGGCCAGGG - Intergenic