ID: 1090620179

View in Genome Browser
Species Human (GRCh38)
Location 11:128553677-128553699
Sequence GAGGGTGGCGGGAGTGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3494
Summary {0: 1, 1: 0, 2: 8, 3: 212, 4: 3273}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090620179_1090620192 16 Left 1090620179 11:128553677-128553699 CCCTCCACACTCCCGCCACCCTC 0: 1
1: 0
2: 8
3: 212
4: 3273
Right 1090620192 11:128553716-128553738 GCCTCTGCCCCTTCGTGAATAGG 0: 1
1: 0
2: 0
3: 5
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090620179 Original CRISPR GAGGGTGGCGGGAGTGTGGA GGG (reversed) Intronic
Too many off-targets to display for this crispr