ID: 1090620512

View in Genome Browser
Species Human (GRCh38)
Location 11:128556590-128556612
Sequence TCCCTGCGTCTTTATGTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 107}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090620512 Original CRISPR TCCCTGCGTCTTTATGTGGG GGG (reversed) Intronic
902161780 1:14536265-14536287 TCCCTACGTTTTTATGAGTGGGG + Intergenic
903354942 1:22740804-22740826 TCCCTGCTTCCTGATGTGGGTGG + Intronic
903523106 1:23969926-23969948 TGCCTGCCTCTTTATGAGGGAGG - Intronic
907669775 1:56464300-56464322 TCCCTGCGTCTCCTGGTGGGTGG + Intergenic
908074429 1:60498686-60498708 TCACTGCAGCTTAATGTGGGAGG + Intergenic
908805881 1:67931597-67931619 CCCCTGTGTCTTAAGGTGGGAGG + Intergenic
908854705 1:68412362-68412384 TCCCAGAGTCTTTATAAGGGAGG - Intergenic
911725857 1:101240061-101240083 CCCCTTCGTCTTTCTGGGGGTGG - Exonic
917101371 1:171449173-171449195 TACCTTTGTGTTTATGTGGGTGG - Intergenic
918512630 1:185328177-185328199 GCCTTCCGTCTTTATGAGGGAGG + Intergenic
923192041 1:231628517-231628539 TCCCTGCATCTTTATGGGACTGG + Intronic
1063249276 10:4255978-4256000 TCCCTGAGTCATCATGTGGAGGG - Intergenic
1063967699 10:11359662-11359684 TCCCTGCATCTCCAAGTGGGAGG + Intergenic
1064778689 10:18808926-18808948 TCCCAGCTACTTGATGTGGGAGG + Intergenic
1067427332 10:46220083-46220105 TCCCTGCTTCTGTGGGTGGGTGG - Intergenic
1067582764 10:47455968-47455990 TCCCTGCTTCTGTGGGTGGGTGG - Intergenic
1068948672 10:62755443-62755465 TCACTGCAACTTTATGAGGGAGG - Intergenic
1073457798 10:103648050-103648072 TTCCTGCGTGGATATGTGGGTGG - Intronic
1074321933 10:112411317-112411339 TCACTGTGTCTTTTTGTGGATGG - Intronic
1076697177 10:132252495-132252517 TACCTGCGTCTTAATTTGAGAGG - Intronic
1080182310 11:29440075-29440097 TCCCAGCTACTTTATTTGGGAGG + Intergenic
1080599812 11:33810267-33810289 TCCCAGCGTTTTTATATGGTTGG + Intergenic
1080799888 11:35600619-35600641 TCCCTGAGGATTTGTGTGGGAGG + Intergenic
1083484907 11:62977155-62977177 TCCCTGCTTCTTTCTGAGTGGGG + Exonic
1089009735 11:115122655-115122677 ACCCTGCAGCTTTCTGTGGGTGG + Intergenic
1089667657 11:120030608-120030630 TTCCAGCCTCTTTAAGTGGGGGG - Intergenic
1090457100 11:126859590-126859612 TCCATGAGTGTTTATGTGTGTGG - Intronic
1090620512 11:128556590-128556612 TCCCTGCGTCTTTATGTGGGGGG - Intronic
1092155227 12:6278233-6278255 TCCCTGCGTCCGTCCGTGGGCGG + Intergenic
1092945804 12:13452939-13452961 TCACTCCATCTTTATGTGGATGG - Intergenic
1100818890 12:98412662-98412684 TCCCTCCCTCTGTCTGTGGGAGG - Intergenic
1101734219 12:107450847-107450869 TCTCTGGGTCTTTATGTAGATGG + Intronic
1102101263 12:110280950-110280972 ACCCTGCGTCTGCAGGTGGGTGG + Intronic
1102815616 12:115863298-115863320 TGCCTGCGTCTTTATGAAGGTGG - Intergenic
1102861457 12:116339866-116339888 TTCATGTGTCTATATGTGGGAGG + Intergenic
1107678967 13:42828043-42828065 TCCCTGTGTCTTCATGTCTGTGG - Intergenic
1109595368 13:64546200-64546222 TCTCTGGGTCCTTATGAGGGTGG + Intergenic
1110226540 13:73125260-73125282 TCCCTGCGTGTTATTGTGGCAGG + Intergenic
1113156916 13:107333556-107333578 TCCGTGAGTATTGATGTGGGGGG + Intronic
1115464884 14:33704139-33704161 TCACTGCGTATTTATGTGCAAGG - Intronic
1117625356 14:57631552-57631574 TGCCTGCCTCGTTATGAGGGAGG + Intronic
1121055520 14:90848914-90848936 TCCCTGCGTATTTATGTCCCAGG - Exonic
1121298100 14:92846593-92846615 TCACTGCCTCTTACTGTGGGAGG + Intergenic
1121657153 14:95605461-95605483 TCCCTGTGTCTCTGTGTGTGTGG + Intergenic
1122381965 14:101314102-101314124 TCCGTGGCTCTCTATGTGGGTGG + Intergenic
1129011609 15:72423358-72423380 TCCCTGCCCCTGTGTGTGGGAGG - Intergenic
1129695539 15:77738890-77738912 TGCCTGCTTCTTCATATGGGAGG - Intronic
1129698412 15:77753855-77753877 TCCCTGCCTCTTTGGGTGAGTGG - Intronic
1130047921 15:80460637-80460659 TCCCCGTGACTTTGTGTGGGGGG - Intronic
1130116704 15:81011761-81011783 TCCCTGTGTGTGTATGTGTGTGG + Intronic
1130421192 15:83748675-83748697 TCCTTGCTTCTTTGTGTGTGTGG - Intronic
1131401913 15:92131946-92131968 TCCCTGCAGCTTAATGAGGGAGG - Intronic
1135039171 16:19104743-19104765 TCCCTGCCTGTACATGTGGGTGG - Intergenic
1137729934 16:50681764-50681786 TCCCTGGGACTTTCTGTTGGTGG - Intergenic
1148124939 17:45231645-45231667 TCCCTGCCTCTTTGTGTGAGTGG + Intronic
1148197835 17:45727488-45727510 TCTCTGCTTCTTTGCGTGGGTGG + Intergenic
1150517685 17:65831131-65831153 TCCTTGCATCTTTATGTTGGTGG - Intronic
1152146873 17:78573702-78573724 TCCCTGGGTCCTCATGTGGTCGG - Intronic
1157862774 18:51156244-51156266 TGCCTACCTCTTTATGAGGGAGG - Intergenic
1161005549 19:1934137-1934159 TCTCTGGGTCTTTGTGTGCGTGG - Intergenic
925091433 2:1159202-1159224 TGCATGAGTGTTTATGTGGGAGG + Intronic
926087523 2:10029398-10029420 TCCCTGCGTTTTCCTCTGGGTGG - Intergenic
932594089 2:73083503-73083525 TCCCTCCATCTTTAGGTGGAGGG - Intronic
937449975 2:121993900-121993922 TCACTGCGTCTCCATGTGGCTGG - Intergenic
938386691 2:130871890-130871912 TCCATGGATCTTTATTTGGGGGG - Intronic
942654721 2:178203591-178203613 TCCCTGCTTCTTTATGTGCCTGG + Intronic
945731713 2:213545697-213545719 TTCCTGTTTTTTTATGTGGGAGG + Intronic
945920985 2:215754269-215754291 CCCCTGCATCTTTGTGTGGCTGG + Intergenic
947120456 2:226808811-226808833 TCCCTGCCCTTTTATCTGGGTGG - Intergenic
1168754916 20:309849-309871 TCCCTGTGTCTTTGTGTTTGGGG - Intergenic
1172230016 20:33330290-33330312 TCCCTCCGTTGTTAAGTGGGAGG - Intergenic
1172409895 20:34713107-34713129 TCCATGTGGCTTTATGTGAGGGG + Exonic
1173357937 20:42312838-42312860 TCCCTGAGTCTTGAAGAGGGAGG + Intronic
1174159514 20:48541057-48541079 TTCCTTTATCTTTATGTGGGTGG + Intergenic
1175785871 20:61711555-61711577 TCACAGCGTCCTTATGAGGGAGG - Intronic
1182028312 22:27137694-27137716 GCCCTTCCTCTTTAGGTGGGAGG + Intergenic
1182551767 22:31104576-31104598 ACGCTGCGTGTGTATGTGGGGGG - Exonic
1184966025 22:47972900-47972922 TGGCTGCGTCCTCATGTGGGGGG + Intergenic
1203241318 22_KI270733v1_random:22749-22771 TCACTGTGTATTTAGGTGGGGGG - Intergenic
949944641 3:9180309-9180331 TCTCCGTGTCTTTCTGTGGGTGG - Intronic
950833340 3:15896800-15896822 TCCCTTCCTCTTAGTGTGGGTGG + Intergenic
952851700 3:37734871-37734893 TCCCAGCATCTGTATGTGGGAGG - Intronic
954933845 3:54308510-54308532 TCCCTGAGTCACTATGTGGAAGG + Intronic
955983317 3:64548580-64548602 CCCCTGGCTATTTATGTGGGGGG + Intronic
958072361 3:88630336-88630358 TCCCTGTGTGTGTGTGTGGGGGG - Intergenic
958120972 3:89287606-89287628 TCCCTGGGTATTTTGGTGGGAGG - Intronic
961401028 3:126643093-126643115 TCCCTGCATCTTCCTGTGGAAGG - Intronic
963065180 3:141258103-141258125 GCCCTGCGTTTGCATGTGGGAGG - Intronic
975791459 4:77957106-77957128 TGCCTGCTTCTTTATGTGGGAGG - Intergenic
983537291 4:168871733-168871755 TCCCAGCCTCTTTTTGGGGGAGG - Intronic
991504715 5:67312423-67312445 TCCCAGCTACTCTATGTGGGAGG + Intergenic
997202663 5:132021169-132021191 GCTCTGCGTCTATATGTGGATGG + Intergenic
998369289 5:141650802-141650824 TTCCTGTGTGTTTATGTGGGTGG + Intronic
1003533404 6:6956031-6956053 ACTCTGCGTCATTCTGTGGGTGG + Intergenic
1010749480 6:79601929-79601951 TTCCTGGGTTTTTTTGTGGGGGG - Intergenic
1011610285 6:89144171-89144193 TCCTTGTGTATATATGTGGGTGG - Intergenic
1018642449 6:165917153-165917175 TCCCTGGGTCTGCGTGTGGGCGG - Intronic
1019409340 7:899807-899829 TCCCTGAGGCATAATGTGGGAGG - Intronic
1022196415 7:28071624-28071646 TCCTTGGGTCTGTATGTGGGTGG - Intronic
1022495587 7:30850998-30851020 TCCCTGAGTCTTTATGGGATGGG - Intronic
1024197631 7:47074732-47074754 TCCCTGTGTCTTTAAGTGCCAGG - Intergenic
1024554313 7:50590327-50590349 TCTCTGCGCCTTTCTGGGGGCGG - Exonic
1027486333 7:78766148-78766170 TCCCTGTGCCTTTATTTGGCCGG + Intronic
1031117811 7:117687297-117687319 TCTCTGCTTCTTTTGGTGGGAGG - Intronic
1033597403 7:142867317-142867339 TCCCTGGGTGTGGATGTGGGAGG + Intronic
1033597421 7:142867418-142867440 TCCCTGTGTGTGGATGTGGGAGG + Intronic
1042961645 8:74309816-74309838 TCCCTGCCACTGAATGTGGGGGG + Intronic
1042961765 8:74310936-74310958 TCCCTGCCTCTGAATGTGAGGGG + Intronic
1043724224 8:83589358-83589380 TGTGTGCGTGTTTATGTGGGGGG + Intergenic
1049352626 8:142172167-142172189 CCCAGGCCTCTTTATGTGGGAGG - Intergenic
1051138496 9:13951383-13951405 TCCTTACTTCTTTATGTGAGGGG - Intergenic
1055983912 9:82036280-82036302 TCCTTGCTTCCTTCTGTGGGAGG + Intergenic
1058932185 9:109732112-109732134 TACCTGCGTCATTATGTGCAGGG + Intronic
1060282096 9:122221567-122221589 TCCCCTCGTGTTTATGGGGGTGG - Intronic
1060950334 9:127597896-127597918 GCTCTGTGTCTTGATGTGGGTGG - Intergenic
1189972689 X:46434250-46434272 TCCCTGTGTCCTCATGTTGGAGG - Intergenic
1192502374 X:71662532-71662554 TCCCAGTGGCTTCATGTGGGTGG - Intergenic
1192504363 X:71671954-71671976 TCCCTGCGGCTTGATGTTGGTGG + Intergenic
1198239358 X:134768018-134768040 TCCCTGTGTCTCTCTGTGTGGGG - Intergenic