ID: 1090620609

View in Genome Browser
Species Human (GRCh38)
Location 11:128557697-128557719
Sequence TGGGGTTTTTATGAAGGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 206}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090620609_1090620616 13 Left 1090620609 11:128557697-128557719 CCTGCACCTTCATAAAAACCCCA 0: 1
1: 0
2: 1
3: 18
4: 206
Right 1090620616 11:128557733-128557755 AACTCTGCTAGAATTTAATATGG 0: 1
1: 0
2: 0
3: 22
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090620609 Original CRISPR TGGGGTTTTTATGAAGGTGC AGG (reversed) Intronic
901530477 1:9849546-9849568 TGGGGCTTTTATGTGGGTTCTGG + Exonic
903080339 1:20805940-20805962 TGGGATTTTTATAAAAGTGGGGG - Intergenic
905373486 1:37501085-37501107 TGGGGTTTGTATGATCATGCTGG - Intronic
906516218 1:46440327-46440349 TGGGGTTGGCATGAAGATGCTGG + Intergenic
907467942 1:54651952-54651974 TGGTGTTTTTAAGCAGGAGCGGG - Exonic
907888286 1:58614248-58614270 TGGGGTTTTTAAGGAGATCCTGG - Intergenic
909107863 1:71435207-71435229 TGCAGTTTTTATGTGGGTGCAGG + Intronic
909267932 1:73586130-73586152 TGTGGTCTTTATGAACATGCAGG - Intergenic
909867108 1:80686842-80686864 AGGGGTTTTTGTGAAAGTGTAGG - Intergenic
910363018 1:86433693-86433715 TGAGTTTCTTAGGAAGGTGCAGG - Intronic
911706531 1:101020245-101020267 TGGTGGTTTTATGGAGGAGCTGG - Intronic
913122341 1:115753645-115753667 TGGGGTCTTTATGGAGGTATTGG - Intronic
915205013 1:154263632-154263654 TGGTGGTTTTATGAAGGTGGGGG + Intronic
915297996 1:154935300-154935322 CGGGGGTTCTATGAAGGTGTGGG - Intronic
917715051 1:177726561-177726583 TGGGGTCTTTCAGAAGGTGGAGG + Intergenic
918556672 1:185809167-185809189 TGGGGTTTTTACTATGGTGAAGG - Intronic
920360978 1:205415998-205416020 TGGCTTTTTTAAGAAGGGGCAGG + Intronic
922616801 1:226965509-226965531 TGGGGTTTTTAGGAGCGTGGTGG + Intronic
924945405 1:248843064-248843086 TGGGGCCTTTAGGAAGGGGCGGG + Intronic
1063818239 10:9802206-9802228 CAGGGTTTTTATGAAGATGTTGG + Intergenic
1064655179 10:17549478-17549500 TGGTGTTTTGATCAAGGTGTTGG + Intergenic
1064985735 10:21208118-21208140 TGGGGTTTTTAAGAAGATTGTGG + Intergenic
1065872820 10:29970652-29970674 TGGGGTTTTCATCATGGTGTGGG - Intergenic
1066375736 10:34856483-34856505 AGGGGTTCTTATGATGCTGCAGG - Intergenic
1068073892 10:52230074-52230096 TGGTGTTTTTATGTTGGTCCTGG - Intronic
1069958777 10:72067655-72067677 TGGAGTTCTCATGAAGGAGCTGG + Exonic
1070637342 10:78139797-78139819 TGGGGTTTTTTTGGTGGTGGGGG + Intergenic
1071410965 10:85394904-85394926 TGGGGTTTTTATGGTGGTTAGGG - Intergenic
1072414770 10:95238089-95238111 TGGTGTGTTTGTGAAGCTGCGGG - Exonic
1073976149 10:109103837-109103859 TGGTGTATTTTTGAAGGTGGGGG + Intergenic
1074122841 10:110505922-110505944 CGGGGGTTTGTTGAAGGTGCTGG - Intronic
1074684385 10:115946597-115946619 TGGGGTTTTTTTGGAGGGGGAGG + Exonic
1076213778 10:128675699-128675721 TGGGGTTTTTACCAAGTGGCAGG - Intergenic
1078739034 11:14049455-14049477 TGGACTTTATCTGAAGGTGCTGG - Intronic
1078933228 11:15929318-15929340 TGTGGTGTTTATGAGGGTGGTGG - Intergenic
1080312926 11:30915072-30915094 TGGTTATTTTATGAAGGTGGAGG + Intronic
1080750840 11:35148559-35148581 TGAGGTTTTTATGAATTTTCAGG - Intronic
1081634028 11:44708897-44708919 TGGGTTTGTTCTGAAGGTCCTGG - Intergenic
1085732019 11:79008016-79008038 TGGGATTTTTATGAGGCCGCTGG + Intronic
1086219277 11:84421789-84421811 TGGCTTTTTCATGAAGCTGCAGG - Intronic
1086285116 11:85238717-85238739 TGCAGCTTTTATGTAGGTGCAGG - Intronic
1088278733 11:108116070-108116092 TGGGGTTTTTATTAAGCTAAAGG - Intergenic
1089835922 11:121370558-121370580 TTCGGTTTTTATAATGGTGCAGG + Intergenic
1090160069 11:124483220-124483242 TGGTGTCTGTATGAAGGTGCTGG - Intergenic
1090163334 11:124518473-124518495 TGGTGTCTGTATGAAGGTGCTGG - Intergenic
1090620609 11:128557697-128557719 TGGGGTTTTTATGAAGGTGCAGG - Intronic
1091790676 12:3270259-3270281 TGGGGTATAGATGGAGGTGCGGG + Intronic
1092137971 12:6162828-6162850 TGGGGTTATTGTGAATGTGAGGG + Intergenic
1092691101 12:11110682-11110704 TGGTGTTTTTCTGAAGTGGCTGG - Intronic
1094053298 12:26243700-26243722 TGGGGTTTTTATGAAATTACTGG + Intronic
1097489012 12:60240891-60240913 TGGGGTCTTCCTGAGGGTGCAGG - Intergenic
1097927918 12:65150937-65150959 AGTGGTTTTTAAGAAGGTCCTGG - Intergenic
1097930266 12:65175954-65175976 GGGGGTTTGTAGGAAGGTGAGGG - Intronic
1099787309 12:87282936-87282958 TGGGGCTTTTTGGAAAGTGCAGG + Intergenic
1100400330 12:94223806-94223828 GTGGATTTTTCTGAAGGTGCAGG + Intronic
1100898565 12:99213130-99213152 TTGGGCTTTTGTGAAGCTGCAGG - Intronic
1101823536 12:108202690-108202712 TGGGGACTGTTTGAAGGTGCAGG + Intronic
1102394120 12:112573838-112573860 TTGGGTTTTTCTAAGGGTGCAGG - Intronic
1105013780 12:132773719-132773741 TGAGGTTTATATAAAGGTGGGGG - Intronic
1107889073 13:44898331-44898353 TGGGGTTTTTCGGAGGGTGGAGG - Intergenic
1108166954 13:47703036-47703058 TGGGGTTGTTGTGAAGTTGTTGG - Intergenic
1108970642 13:56371305-56371327 TAGAGTTTTTATGAAGATTCAGG - Intergenic
1109000510 13:56796565-56796587 TGGGGTCTATTTGAAGGTGAAGG + Intergenic
1109398319 13:61790201-61790223 TGGGGTTTTAACCAAGGTCCAGG - Intergenic
1109792193 13:67263711-67263733 TGAGGTTTTAATGTAGGAGCAGG - Intergenic
1115692062 14:35854881-35854903 TGGGATTTCTTGGAAGGTGCAGG + Intronic
1118706662 14:68486426-68486448 TGGGGTTTGGACGATGGTGCTGG - Intronic
1124844727 15:33279259-33279281 AGGGGTCTTTATAAAGGTGCAGG + Intergenic
1127066254 15:55242630-55242652 TGTGATTTTTCTGAAGGTTCAGG - Intronic
1128608660 15:69056923-69056945 TGGGGTTTCTGTGAAAGTGAGGG + Exonic
1128865735 15:71114365-71114387 AGGGGTTGTTTTGAAAGTGCAGG - Intronic
1129100391 15:73256687-73256709 TGGGGTTCTTGTGAAGAAGCTGG - Intronic
1129363742 15:75041667-75041689 TGAGGTTTTTTTGCAGGTTCTGG + Intronic
1130319380 15:82828028-82828050 TTGGGTCTTTGTGAAGGGGCTGG - Intronic
1131601058 15:93849431-93849453 TGGGGTCTTTAAGGAGGTGATGG + Intergenic
1137427140 16:48389225-48389247 TGAGGTTTTTATGTAGCTGGTGG + Intronic
1139758642 16:69166240-69166262 TGGTGTGTTTGTGAAGGTGGGGG + Intronic
1139938643 16:70589394-70589416 TGGGGTCTATCTGAAGGTGGAGG - Intronic
1140665123 16:77220556-77220578 TGGGGTATTTGTGAAGCAGCAGG + Intergenic
1141752502 16:85968245-85968267 TGGGGGTTTTTGGAAAGTGCAGG + Intergenic
1143188567 17:5024722-5024744 TTGGGTTTTCATGGAGGTGTAGG + Exonic
1143941315 17:10545210-10545232 TGGTGTATTTATGAAGGAGAAGG - Intronic
1148545366 17:48514613-48514635 TGGGGTTTTTAACAAGGTGGGGG + Intergenic
1151187519 17:72374798-72374820 TGGGGTTTGGAGGAGGGTGCCGG - Intergenic
1151959067 17:77395804-77395826 TGTGATTTTAATGATGGTGCAGG + Intronic
1153186010 18:2487258-2487280 TGGGGTTTACTTGAAGGTGGAGG + Intergenic
1153387341 18:4511858-4511880 TGGTGTTTCTTTGAAAGTGCAGG + Intergenic
1159538629 18:69747469-69747491 TGGGAATTTTATGAAGGTATTGG - Intronic
1160914366 19:1489795-1489817 TGGGGTTTTTCTTCAGGTGCAGG + Exonic
1161091836 19:2364275-2364297 TGGGGTTTTATTGAAGTTGATGG + Intergenic
1161852278 19:6743895-6743917 TGGGGTTTTGATGAATGCGTAGG - Intronic
1162673542 19:12279481-12279503 TGGGGTTTTTTTGGGGGTGGGGG - Intronic
1162864592 19:13535205-13535227 TGGGGCCTTTTTGAAGGTGGGGG + Intronic
1163256426 19:16158670-16158692 TGGGGTTTTCATGCAGATGAAGG + Intergenic
1163798045 19:19348517-19348539 TGGGATTTCTCTGGAGGTGCAGG - Intronic
1164742778 19:30589019-30589041 TGGGGTGTTTCTGAATGTGCTGG + Intronic
1165082070 19:33313136-33313158 TGGGGTTTACTTGAAGGTGGGGG + Intergenic
1166965788 19:46528736-46528758 GGGGGTTATGATGAAGCTGCAGG - Intronic
925313472 2:2904739-2904761 TGGGTTTTTTAAGATGGTGAGGG - Intergenic
925634322 2:5927880-5927902 AGGGATTTTTTTGAAGGTGATGG + Intergenic
926161709 2:10494453-10494475 TGGGGTTTTGATCCAGCTGCTGG - Intergenic
928306002 2:30170934-30170956 TAGGGTTTTTATGAAGATAAAGG + Intergenic
928914156 2:36454156-36454178 TGGGGTTATTATGGGGGTACTGG - Intronic
928932039 2:36634939-36634961 TGGGGTTTATATGAGGCAGCTGG - Intronic
929714689 2:44298247-44298269 TGGGATTTTTGTGAGGGTGATGG - Intronic
930527999 2:52555350-52555372 TGGGGTTTTTATGATGGTAAAGG - Intergenic
931596514 2:63951095-63951117 TGCAGATTTTATGCAGGTGCAGG - Intronic
932174630 2:69588335-69588357 TAGAGTTTTTCTGAAGGTGCAGG - Intronic
932318946 2:70806601-70806623 TGCAGTTTTTATGTGGGTGCAGG + Intergenic
933209024 2:79544575-79544597 TAAGCTTTTTATGAAAGTGCAGG + Intronic
933541578 2:83650411-83650433 AGTGGTTTGTATGAATGTGCTGG + Intergenic
935070548 2:99690103-99690125 TGGGGTTTTTTTGGGGGTGGGGG - Intronic
935226387 2:101056706-101056728 AGGGGTCTTTATGAAGGCTCCGG + Intronic
937626246 2:124047175-124047197 TGGGGTTATTATGAAGATTAAGG - Intronic
937706461 2:124926414-124926436 TTGGGTTTCTGTGAAGGAGCTGG + Intergenic
939375914 2:141367034-141367056 TGGACATTTTATGAAGGTTCAGG - Intronic
940863920 2:158798013-158798035 TGGGGTTCTTCTGAAAGTGAGGG - Intronic
941869613 2:170370514-170370536 TGGGGTCTTTTTGAAGCAGCAGG + Intronic
946500169 2:220238724-220238746 TGGGTTATTTAGGAAGTTGCTGG + Intergenic
1169042519 20:2508184-2508206 TGGGGTTTTTAGGGAGGTGAGGG - Intronic
1169582843 20:7044422-7044444 TGGGGTTGTAATCAAGGTGTTGG - Intergenic
1169584487 20:7065560-7065582 AGGTATTCTTATGAAGGTGCTGG + Intergenic
1169971788 20:11276471-11276493 TGGGATTTTTATAAATGTGTTGG - Intergenic
1170130374 20:13012661-13012683 TGGGGCTGTTTTGAAGGTACAGG - Intronic
1171201997 20:23249631-23249653 AGGGGTTGTGATGGAGGTGCTGG + Intergenic
1174862761 20:54107341-54107363 TGTGATTTTTATGAACGTGTTGG + Intergenic
1176795899 21:13371243-13371265 TGGGGTGTGTAAGAAGCTGCTGG - Intergenic
1181181375 22:21070885-21070907 TGAGGTTTTTATGCAGGTCCTGG - Intergenic
1181744002 22:24943084-24943106 TGGGGTTTTTTTGGTGGTGGTGG + Intronic
1182058641 22:27380868-27380890 TGGGTTTCTAATGAATGTGCGGG + Intergenic
1184101640 22:42344122-42344144 TGGGGGTTTTCTGAAGGCGTGGG - Intergenic
1185005376 22:48273171-48273193 TGGGGATTTTGTGAATGTCCTGG + Intergenic
949507037 3:4738049-4738071 TGGGGCTTTTCGGAAGGTGGAGG + Intronic
949860052 3:8496958-8496980 TTGGGGATTTATGAAGGTGTTGG + Intergenic
950979857 3:17290658-17290680 TGGGGTTTTTTTGGGGGTGTAGG + Intronic
953568513 3:44053270-44053292 TGGGGTTGTTCTGCAGGTGAGGG - Intergenic
955038448 3:55291832-55291854 TGGGGATCTTATGATGCTGCAGG + Intergenic
956190488 3:66603076-66603098 TGGGGTTGGAATGAAGGTGTTGG + Intergenic
956246772 3:67192334-67192356 TGGGATTGTTATGAAGGTATCGG + Intergenic
957533159 3:81466483-81466505 TTGGGTTTTTATGAATTTGAGGG + Intergenic
958495083 3:94834797-94834819 TGGGGTCTATATGAGGGTGGAGG + Intergenic
958610954 3:96425354-96425376 TGGATTTTTTATGAAGGAGCAGG + Intergenic
958689641 3:97447441-97447463 TAGGGTTTTTATGAGGATGGTGG + Intronic
960307742 3:116082874-116082896 TGGGGTTTATTTGAGGGTGGAGG + Intronic
961961046 3:130855422-130855444 AGGTGTTTTTATGCAGGTGAGGG + Intronic
967799129 3:193634887-193634909 TGGGGTTTTTGTGAAGGCTAAGG + Intronic
971339822 4:25757784-25757806 TGGGCTTTGTCTGCAGGTGCTGG - Exonic
971512529 4:27444858-27444880 TGGTATTTTTAGGAAGGTTCTGG - Intergenic
971822092 4:31570618-31570640 TGGGGTTTTTTTGTAGCTACAGG + Intergenic
972735825 4:41840214-41840236 TGGAGTTTTCTTGAAGCTGCTGG + Intergenic
974203185 4:58667254-58667276 TGGTGAACTTATGAAGGTGCCGG - Intergenic
974559931 4:63504589-63504611 AGAGGTTTTTATGAAGATGTTGG - Intergenic
975760385 4:77614285-77614307 TGGGGTTTTGGGGAAGGGGCTGG + Intergenic
978945575 4:114491782-114491804 TGGGATTATTGAGAAGGTGCTGG + Intergenic
979318926 4:119300542-119300564 TAGGGTTGTTACGAAGCTGCAGG - Exonic
983857320 4:172662081-172662103 TGGGGATCTTATTAAAGTGCAGG - Intronic
987691062 5:21267732-21267754 TGAGGTTTTTAAGAAGGAGGAGG + Intergenic
988030029 5:25752184-25752206 TGGGGTGTTTATATAAGTGCTGG + Intergenic
990354333 5:54950971-54950993 TTGGGTTTGTTTGAAGGTGATGG + Intergenic
993193524 5:84709139-84709161 TGGGGCCTTTCTGAGGGTGCAGG - Intergenic
993214960 5:85008596-85008618 TGGTGTTTTTATGAAGGCTGTGG - Intergenic
993261730 5:85666200-85666222 TGCAGCTTTTATGTAGGTGCAGG + Intergenic
994332120 5:98518676-98518698 TAGGGTTTTTATGAAGTTGAAGG + Intergenic
995664526 5:114526580-114526602 TGGGGCCTTTTTGAGGGTGCAGG + Intergenic
996863840 5:128095318-128095340 TGGGTTTTTTTAGAAGGTCCTGG + Intronic
997006262 5:129819952-129819974 TAGGGTTTTTTTGAAAGTGTGGG + Intergenic
998644707 5:144049052-144049074 TGGGGTTTTTGTGGTGGTGGGGG - Intergenic
998963583 5:147513234-147513256 TGGGGTTCTTATGAAGGTTAAGG - Intergenic
999350415 5:150864922-150864944 TGGGGTTTTCATGAAGCATCAGG - Intronic
1001324962 5:170716711-170716733 TGCATTTTTTATGAAGGTGATGG + Intronic
1001980439 5:176034374-176034396 TGGGGTGTGTAGGAAGCTGCTGG - Intronic
1002237022 5:177809691-177809713 TGGGGTGTGTAGGAAGCTGCTGG + Intergenic
1003447021 6:6194146-6194168 AGGGGTTGTTATGAAGTTGTGGG - Intronic
1004446559 6:15705234-15705256 TGCAGCTTTTATGTAGGTGCAGG + Intergenic
1004802802 6:19169467-19169489 TGCGGAGATTATGAAGGTGCTGG - Intergenic
1004981607 6:21030828-21030850 GGGGGATTTTAAGAAGGGGCAGG + Intronic
1008497813 6:52151003-52151025 TGGAGTTTAGTTGAAGGTGCTGG + Intergenic
1013059898 6:106623373-106623395 TGGGGTTTTTCAGAGGGTGGAGG + Intronic
1014500989 6:122189160-122189182 TGGGGTCTTTCAGAAGGTGGAGG - Intergenic
1015266942 6:131298946-131298968 TGTGGTTTTGTAGAAGGTGCTGG - Intergenic
1017327521 6:153156519-153156541 TGGAGTTTTTATTTATGTGCAGG + Intergenic
1018391749 6:163346346-163346368 CGGGGTATTTCTGAAGGTGAAGG - Intergenic
1019693961 7:2434145-2434167 TGTGGTTTTTCTGAGCGTGCGGG + Exonic
1020825003 7:13016317-13016339 TCGGGTTTTTATCAAGATGGGGG - Intergenic
1020885696 7:13816776-13816798 TGAGGTTTGTATGAAGGATCCGG + Intergenic
1023215290 7:37855822-37855844 TGCAGCTTTTATGCAGGTGCAGG - Intronic
1029945814 7:104531832-104531854 TGGTGGTTTTGTCAAGGTGCTGG + Intronic
1031141056 7:117944080-117944102 TGGGGTTTTTAGGGAGGTGAGGG + Intergenic
1035133022 7:156673625-156673647 TGGGGTTTGAATGAAGGGGGTGG - Intronic
1035219130 7:157395103-157395125 TGGGGTTTTTTGGGAGGTGGGGG - Intronic
1037801315 8:22037399-22037421 AAAGGTTTTTTTGAAGGTGCGGG - Intergenic
1038067844 8:23982309-23982331 TGGGGTTTATATTAGGGTCCAGG + Intergenic
1039695965 8:39911945-39911967 TGAGGTTTTTAGGGAGGTGTAGG + Intronic
1040386839 8:46919842-46919864 TAGGGTGTTTGTGAAGGTGAAGG + Intergenic
1041297531 8:56374279-56374301 TGGGCCTTGTATGAAGTTGCTGG + Intergenic
1041959432 8:63595646-63595668 GGGCATTTTTATGAAGGTGATGG - Intergenic
1043503918 8:80884371-80884393 TGGGGTTTATATGGAGGAGGTGG - Intergenic
1043799346 8:84588075-84588097 TGGGGTTTGCTTGAAGGTCCAGG + Intronic
1044444109 8:92253749-92253771 TGGGGCTTTTCTGAGGGTGGAGG + Intergenic
1044764764 8:95559733-95559755 TGGAGTTTTGAGGAAGGTGATGG - Intergenic
1045005981 8:97917142-97917164 TTGTTGTTTTATGAAGGTGCTGG - Intronic
1045558051 8:103233865-103233887 TGGGGTTCCTATGAAGGTAGAGG - Intergenic
1046447957 8:114347703-114347725 TGGGGCCTTTAGGAAGGTGGAGG + Intergenic
1047246592 8:123150689-123150711 TGGGGTTTTTTAGAAGGGACAGG + Intronic
1047944005 8:129856646-129856668 TGGGGTTTTTTTAAAGTTACGGG - Intronic
1049534833 8:143174300-143174322 TAGGGTTCTTATGAAGCTGAAGG + Intergenic
1049717276 8:144098953-144098975 TGGGGCATTGATGAAGGTGCAGG + Exonic
1050115345 9:2257754-2257776 TGGGGTTTGTCAGCAGGTGCAGG - Intergenic
1050395843 9:5195154-5195176 TGGGGGGTGTAGGAAGGTGCCGG - Intergenic
1050689356 9:8207929-8207951 TGGTGGTTTTAGGAAGGTGAGGG - Intergenic
1050715542 9:8520922-8520944 TGGGGTTCTTATCAAGGTTCTGG + Intronic
1050873620 9:10608389-10608411 TGGAGTGTTTTTGAAGGAGCAGG - Intronic
1051350979 9:16197683-16197705 TGGGCTTTTTAAGAATGTCCAGG + Intergenic
1051805297 9:20986074-20986096 TATGGTTTTAATGAAGGAGCAGG + Intronic
1057068100 9:92073799-92073821 TGGGGTTTGTTTTAAGGTGGAGG - Intronic
1062196245 9:135275789-135275811 TGGGCTTTCCATGAAAGTGCTGG - Intergenic
1189339766 X:40195948-40195970 TGGGGATTTTATGATGTCGCTGG + Intergenic
1191189382 X:57650344-57650366 TTTGGCTTTTATGATGGTGCAGG + Intergenic
1191844099 X:65533751-65533773 AGGGCTCTTTATGATGGTGCTGG - Intronic
1191910122 X:66141164-66141186 TGGGGTCTATTTGAAGGTGGAGG - Intergenic
1192077783 X:68017857-68017879 TGGGGTTGCTAAGAAAGTGCTGG + Intergenic
1194435206 X:93860836-93860858 TGGTGTTTTTATGATAGTGAGGG + Intergenic
1195928879 X:110053539-110053561 TGGGGTTTTTATGATGGTGGGGG - Intronic
1195982207 X:110591202-110591224 TTCAGTTTTTATGATGGTGCAGG - Intergenic
1197197838 X:123721143-123721165 TGGGGTTTTTTTGTTGTTGCTGG + Intronic
1201471199 Y:14336674-14336696 TGGGATTTTTATGAAGGAAATGG + Intergenic