ID: 1090621326

View in Genome Browser
Species Human (GRCh38)
Location 11:128563588-128563610
Sequence AGGTTGTCAGTCGTAAGGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 54}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090621326_1090621331 6 Left 1090621326 11:128563588-128563610 CCTGACCTTACGACTGACAACCT 0: 1
1: 0
2: 0
3: 1
4: 54
Right 1090621331 11:128563617-128563639 GATAAACAGCCACACCACGGTGG 0: 1
1: 0
2: 0
3: 4
4: 90
1090621326_1090621330 3 Left 1090621326 11:128563588-128563610 CCTGACCTTACGACTGACAACCT 0: 1
1: 0
2: 0
3: 1
4: 54
Right 1090621330 11:128563614-128563636 TTGGATAAACAGCCACACCACGG 0: 1
1: 0
2: 2
3: 7
4: 149
1090621326_1090621332 7 Left 1090621326 11:128563588-128563610 CCTGACCTTACGACTGACAACCT 0: 1
1: 0
2: 0
3: 1
4: 54
Right 1090621332 11:128563618-128563640 ATAAACAGCCACACCACGGTGGG 0: 1
1: 0
2: 0
3: 4
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090621326 Original CRISPR AGGTTGTCAGTCGTAAGGTC AGG (reversed) Intronic
923392653 1:233529631-233529653 AGGTGGTCAGTGGTAAGGCTGGG + Intergenic
923952832 1:238979018-238979040 ACGTTGTCAGTCATAAGATGGGG + Intergenic
1067362154 10:45592676-45592698 TGGTTGTCAGTAGTAGCGTCTGG - Intronic
1070592671 10:77811819-77811841 AGGGTGCCAGCCGTAAGTTCTGG - Intronic
1084288185 11:68145441-68145463 AGGTTCCCAGTCATTAGGTCAGG - Intergenic
1087150967 11:94859259-94859281 AGCTTATCAGTAGTAGGGTCAGG - Intronic
1088280158 11:108127202-108127224 TGGTGGTCAGTTGAAAGGTCAGG + Intronic
1089847861 11:121472433-121472455 AGCATGTCAGTGGGAAGGTCGGG + Intronic
1090366810 11:126213004-126213026 AGGTGGTCAGTGATGAGGTCTGG + Intronic
1090621326 11:128563588-128563610 AGGTTGTCAGTCGTAAGGTCAGG - Intronic
1106706956 13:32291029-32291051 AGGTGGTTAGACGTGAGGTCAGG + Intronic
1113743864 13:112729237-112729259 AGGTGGCCTGTCATAAGGTCAGG - Intronic
1119473376 14:74912836-74912858 ACGCTGTCAATCGCAAGGTCAGG + Intronic
1120143900 14:80958331-80958353 AGCTTGTAAGTGGTAAAGTCAGG + Intronic
1121682749 14:95807881-95807903 AGAATGTCAGTGGTAAGTTCAGG + Intergenic
1124818568 15:33020136-33020158 AGTTGGTCAGTCAGAAGGTCTGG + Intronic
1124984531 15:34593179-34593201 AAGTTTTCAGTCCTCAGGTCTGG + Intergenic
1125276457 15:37997116-37997138 AGTTTGACAGTCATAAGTTCTGG + Intergenic
1125335008 15:38618343-38618365 GGGCTGTCAGTCTTAAGGGCAGG + Intergenic
1129497070 15:75994074-75994096 AACATGTCACTCGTAAGGTCTGG - Intronic
1133668962 16:7998899-7998921 AGGTTGTCAGTTCTAAGGCCTGG - Intergenic
1134192887 16:12136148-12136170 ATGTTGTCAGTGGTATGGCCGGG + Intronic
1138066963 16:53952206-53952228 AGGTTGTCAGTGGTCAAGCCAGG + Intronic
1141496775 16:84415796-84415818 AGGTTGTCAGGCTTAAAGTGAGG - Intronic
1143986437 17:10918738-10918760 AGGTTGTTGGACCTAAGGTCAGG - Intergenic
1157730722 18:50001800-50001822 AGGTGGTGAGTCATGAGGTCAGG + Intronic
1163245408 19:16090724-16090746 AGATTGTAAGTTGTAAGGACAGG + Intronic
929052925 2:37853265-37853287 AGTTTCTCAGTCGGCAGGTCTGG - Intergenic
929487402 2:42367233-42367255 AGCTTGTCAGTAGGAAGATCTGG - Intronic
937645768 2:124264620-124264642 AGGTTGTCAGTGGAGAGCTCAGG + Intronic
942139936 2:172967668-172967690 AGGTTGTCAGTAGTTGGCTCCGG + Intronic
947140131 2:227013010-227013032 AGCTTGTCAGGCGCAGGGTCTGG - Intronic
1174510468 20:51047628-51047650 AGGTTGTCTGACTTAAGGGCAGG + Intergenic
956276169 3:67503593-67503615 ACGTTGACAATCTTAAGGTCCGG - Intronic
958965260 3:100551330-100551352 AGGTTGTAAGTGGTAGGATCAGG + Intronic
966622691 3:181983023-181983045 AGCTTGTCAGTGGCAAAGTCAGG + Intergenic
980834961 4:138179947-138179969 AGGTTGTCAGTCATGTTGTCAGG - Intronic
985155387 4:186982604-186982626 ATGGGGTCAGTCGTAGGGTCTGG - Intergenic
986565148 5:9105618-9105640 AGGGTGCCATCCGTAAGGTCTGG - Intronic
989133164 5:38127043-38127065 AGGTGGTCAGATGAAAGGTCTGG + Intergenic
994126794 5:96176684-96176706 AGTTTGTCAGTCACAAGGACTGG + Intergenic
997520295 5:134519266-134519288 AGGTTCTCAGTAGGCAGGTCTGG - Intergenic
1021873602 7:25028054-25028076 AGCTAGTGAGTAGTAAGGTCTGG + Intergenic
1022968831 7:35498530-35498552 AGGTAGTCAGTGGGAAGGTGTGG + Intergenic
1024903349 7:54347634-54347656 AGGATTTCTGTGGTAAGGTCTGG - Intergenic
1024914517 7:54484331-54484353 AGGTTGCCACTCCCAAGGTCTGG - Intergenic
1027468503 7:78544450-78544472 AGTTTGTCATTTGTAAGGTGGGG + Intronic
1031931306 7:127688510-127688532 ATGTTGTCAGTTGTCAGGACTGG - Intronic
1035260994 7:157661630-157661652 AGGTTGGCAGTGATAAGGCCAGG + Intronic
1036945292 8:13089395-13089417 AGGTGGGCAGTCACAAGGTCAGG + Intronic
1038063370 8:23936892-23936914 AGGTTGTCAGACTTATGGCCTGG + Intergenic
1039715452 8:40103382-40103404 AGGTTGTCAGTCAAAAGCACAGG - Intergenic
1043864300 8:85358127-85358149 AGGTGGGCAGTGGTAAGGGCAGG + Intronic
1046061655 8:109146966-109146988 AGCTTGTCAGTGGTAAAGACAGG + Intergenic
1046630937 8:116622539-116622561 AGGTTGTAAATGGCAAGGTCAGG - Intergenic
1056765258 9:89441217-89441239 GGGTTGGTATTCGTAAGGTCTGG - Intronic