ID: 1090624555

View in Genome Browser
Species Human (GRCh38)
Location 11:128594642-128594664
Sequence TGGCTATGTTGAGGGAGTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090624555_1090624562 6 Left 1090624555 11:128594642-128594664 CCCTTACTCCCTCAACATAGCCA No data
Right 1090624562 11:128594671-128594693 TCTGTGTACTCAGAGGCTCAGGG No data
1090624555_1090624560 -1 Left 1090624555 11:128594642-128594664 CCCTTACTCCCTCAACATAGCCA No data
Right 1090624560 11:128594664-128594686 AAGACTATCTGTGTACTCAGAGG No data
1090624555_1090624561 5 Left 1090624555 11:128594642-128594664 CCCTTACTCCCTCAACATAGCCA No data
Right 1090624561 11:128594670-128594692 ATCTGTGTACTCAGAGGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090624555 Original CRISPR TGGCTATGTTGAGGGAGTAA GGG (reversed) Intergenic
No off target data available for this crispr