ID: 1090632800

View in Genome Browser
Species Human (GRCh38)
Location 11:128664935-128664957
Sequence TGAATCACAGGTGGCCCCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090632800_1090632806 3 Left 1090632800 11:128664935-128664957 CCATTGGGGCCACCTGTGATTCA No data
Right 1090632806 11:128664961-128664983 GGAGAACAGGCAAACATACCAGG No data
1090632800_1090632810 30 Left 1090632800 11:128664935-128664957 CCATTGGGGCCACCTGTGATTCA No data
Right 1090632810 11:128664988-128665010 TGTTCCCAATAAGTGGATCCTGG No data
1090632800_1090632805 -10 Left 1090632800 11:128664935-128664957 CCATTGGGGCCACCTGTGATTCA No data
Right 1090632805 11:128664948-128664970 CTGTGATTCATTGGGAGAACAGG No data
1090632800_1090632808 23 Left 1090632800 11:128664935-128664957 CCATTGGGGCCACCTGTGATTCA No data
Right 1090632808 11:128664981-128665003 AGGAACCTGTTCCCAATAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090632800 Original CRISPR TGAATCACAGGTGGCCCCAA TGG (reversed) Intergenic