ID: 1090632805

View in Genome Browser
Species Human (GRCh38)
Location 11:128664948-128664970
Sequence CTGTGATTCATTGGGAGAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090632800_1090632805 -10 Left 1090632800 11:128664935-128664957 CCATTGGGGCCACCTGTGATTCA No data
Right 1090632805 11:128664948-128664970 CTGTGATTCATTGGGAGAACAGG No data
1090632795_1090632805 13 Left 1090632795 11:128664912-128664934 CCACTGACAACCTCTATGGAACT No data
Right 1090632805 11:128664948-128664970 CTGTGATTCATTGGGAGAACAGG No data
1090632793_1090632805 21 Left 1090632793 11:128664904-128664926 CCTGACTGCCACTGACAACCTCT No data
Right 1090632805 11:128664948-128664970 CTGTGATTCATTGGGAGAACAGG No data
1090632799_1090632805 3 Left 1090632799 11:128664922-128664944 CCTCTATGGAACTCCATTGGGGC No data
Right 1090632805 11:128664948-128664970 CTGTGATTCATTGGGAGAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090632805 Original CRISPR CTGTGATTCATTGGGAGAAC AGG Intergenic