ID: 1090632806

View in Genome Browser
Species Human (GRCh38)
Location 11:128664961-128664983
Sequence GGAGAACAGGCAAACATACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090632800_1090632806 3 Left 1090632800 11:128664935-128664957 CCATTGGGGCCACCTGTGATTCA No data
Right 1090632806 11:128664961-128664983 GGAGAACAGGCAAACATACCAGG No data
1090632795_1090632806 26 Left 1090632795 11:128664912-128664934 CCACTGACAACCTCTATGGAACT No data
Right 1090632806 11:128664961-128664983 GGAGAACAGGCAAACATACCAGG No data
1090632799_1090632806 16 Left 1090632799 11:128664922-128664944 CCTCTATGGAACTCCATTGGGGC No data
Right 1090632806 11:128664961-128664983 GGAGAACAGGCAAACATACCAGG No data
1090632804_1090632806 -9 Left 1090632804 11:128664947-128664969 CCTGTGATTCATTGGGAGAACAG No data
Right 1090632806 11:128664961-128664983 GGAGAACAGGCAAACATACCAGG No data
1090632803_1090632806 -6 Left 1090632803 11:128664944-128664966 CCACCTGTGATTCATTGGGAGAA No data
Right 1090632806 11:128664961-128664983 GGAGAACAGGCAAACATACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090632806 Original CRISPR GGAGAACAGGCAAACATACC AGG Intergenic