ID: 1090632810

View in Genome Browser
Species Human (GRCh38)
Location 11:128664988-128665010
Sequence TGTTCCCAATAAGTGGATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090632803_1090632810 21 Left 1090632803 11:128664944-128664966 CCACCTGTGATTCATTGGGAGAA No data
Right 1090632810 11:128664988-128665010 TGTTCCCAATAAGTGGATCCTGG No data
1090632804_1090632810 18 Left 1090632804 11:128664947-128664969 CCTGTGATTCATTGGGAGAACAG No data
Right 1090632810 11:128664988-128665010 TGTTCCCAATAAGTGGATCCTGG No data
1090632800_1090632810 30 Left 1090632800 11:128664935-128664957 CCATTGGGGCCACCTGTGATTCA No data
Right 1090632810 11:128664988-128665010 TGTTCCCAATAAGTGGATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090632810 Original CRISPR TGTTCCCAATAAGTGGATCC TGG Intergenic