ID: 1090635187

View in Genome Browser
Species Human (GRCh38)
Location 11:128686607-128686629
Sequence GAGGCTTCTCCCTCCCAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 353
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 321}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090635176_1090635187 13 Left 1090635176 11:128686571-128686593 CCCACCGTCTCTCCCTCGCTCCA 0: 1
1: 0
2: 2
3: 67
4: 1404
Right 1090635187 11:128686607-128686629 GAGGCTTCTCCCTCCCAGGCTGG 0: 1
1: 0
2: 1
3: 30
4: 321
1090635172_1090635187 30 Left 1090635172 11:128686554-128686576 CCCCACTTCATCACCATCCCACC 0: 1
1: 0
2: 4
3: 41
4: 404
Right 1090635187 11:128686607-128686629 GAGGCTTCTCCCTCCCAGGCTGG 0: 1
1: 0
2: 1
3: 30
4: 321
1090635178_1090635187 9 Left 1090635178 11:128686575-128686597 CCGTCTCTCCCTCGCTCCACTCG 0: 1
1: 0
2: 5
3: 80
4: 1105
Right 1090635187 11:128686607-128686629 GAGGCTTCTCCCTCCCAGGCTGG 0: 1
1: 0
2: 1
3: 30
4: 321
1090635184_1090635187 -7 Left 1090635184 11:128686591-128686613 CCACTCGCGGGTAACCGAGGCTT 0: 1
1: 0
2: 0
3: 1
4: 20
Right 1090635187 11:128686607-128686629 GAGGCTTCTCCCTCCCAGGCTGG 0: 1
1: 0
2: 1
3: 30
4: 321
1090635173_1090635187 29 Left 1090635173 11:128686555-128686577 CCCACTTCATCACCATCCCACCG 0: 1
1: 0
2: 0
3: 15
4: 192
Right 1090635187 11:128686607-128686629 GAGGCTTCTCCCTCCCAGGCTGG 0: 1
1: 0
2: 1
3: 30
4: 321
1090635177_1090635187 12 Left 1090635177 11:128686572-128686594 CCACCGTCTCTCCCTCGCTCCAC 0: 1
1: 0
2: 8
3: 157
4: 2013
Right 1090635187 11:128686607-128686629 GAGGCTTCTCCCTCCCAGGCTGG 0: 1
1: 0
2: 1
3: 30
4: 321
1090635174_1090635187 28 Left 1090635174 11:128686556-128686578 CCACTTCATCACCATCCCACCGT 0: 1
1: 0
2: 1
3: 7
4: 181
Right 1090635187 11:128686607-128686629 GAGGCTTCTCCCTCCCAGGCTGG 0: 1
1: 0
2: 1
3: 30
4: 321
1090635182_1090635187 0 Left 1090635182 11:128686584-128686606 CCTCGCTCCACTCGCGGGTAACC 0: 1
1: 0
2: 0
3: 1
4: 37
Right 1090635187 11:128686607-128686629 GAGGCTTCTCCCTCCCAGGCTGG 0: 1
1: 0
2: 1
3: 30
4: 321
1090635175_1090635187 17 Left 1090635175 11:128686567-128686589 CCATCCCACCGTCTCTCCCTCGC 0: 1
1: 0
2: 12
3: 723
4: 8691
Right 1090635187 11:128686607-128686629 GAGGCTTCTCCCTCCCAGGCTGG 0: 1
1: 0
2: 1
3: 30
4: 321
1090635181_1090635187 1 Left 1090635181 11:128686583-128686605 CCCTCGCTCCACTCGCGGGTAAC 0: 1
1: 0
2: 0
3: 0
4: 21
Right 1090635187 11:128686607-128686629 GAGGCTTCTCCCTCCCAGGCTGG 0: 1
1: 0
2: 1
3: 30
4: 321

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090635187 Original CRISPR GAGGCTTCTCCCTCCCAGGC TGG Intronic
900152591 1:1185128-1185150 GAGGGATCTCACTCCCAGACTGG - Intronic
900395669 1:2452307-2452329 GGGGCTGCTACCTGCCAGGCAGG - Intronic
900851186 1:5144403-5144425 GAGGCATCTCCATGCCAGCCTGG - Intergenic
901061406 1:6473538-6473560 GACCCTCCTCCATCCCAGGCTGG - Intronic
901069417 1:6509717-6509739 TAGGCTTCTGCCTCCCAAGCTGG + Intronic
901536995 1:9889002-9889024 CAGGCGCCTCCCTCCCAGCCTGG - Intronic
901934845 1:12619898-12619920 AAGGCCTGTCACTCCCAGGCTGG - Intergenic
902224384 1:14987579-14987601 CAGCCTTCTCCCTGCCTGGCAGG - Intronic
903785301 1:25857273-25857295 GAGTCTTCTGTCACCCAGGCTGG + Intronic
903805911 1:26005527-26005549 AATGCTTCCCCCTCCCAGGTAGG - Intergenic
903830018 1:26169160-26169182 GAGCCTGGTGCCTCCCAGGCTGG - Intergenic
904289127 1:29472228-29472250 GACCCTTCCCCCACCCAGGCAGG - Intergenic
904292741 1:29498244-29498266 GAGCCCTCTCCCATCCAGGCTGG - Intergenic
904437737 1:30509661-30509683 GGGGCTGCTTCATCCCAGGCTGG + Intergenic
904611133 1:31726971-31726993 TAGGCCGCCCCCTCCCAGGCAGG + Intergenic
905823702 1:41013969-41013991 GAGGCTTCTCCCTCATGGGGAGG + Intergenic
906420913 1:45666150-45666172 GAGTCTTCTGTCACCCAGGCTGG + Intronic
906948205 1:50313605-50313627 GAGGCTCCTCCATCCCTGGCAGG - Intergenic
907962563 1:59296989-59297011 GAGGCTTCTCCAACCCGGCCCGG + Exonic
907963930 1:59310756-59310778 GAGCAGTCTCCCTCCCAAGCAGG - Intronic
910763508 1:90758330-90758352 GATACTTCTCCTTCACAGGCAGG - Intergenic
912446513 1:109740539-109740561 GAGGCTCCTCCCTTCCCCGCGGG + Intronic
915447588 1:155982932-155982954 GGGGTTTCTGTCTCCCAGGCTGG - Intronic
915946380 1:160155154-160155176 GAGGCTTCTCCCTCCTACTATGG + Exonic
919799739 1:201346422-201346444 GAGGCTTCTCAGTCCTAGCCAGG - Intergenic
924117817 1:240764630-240764652 CAGTCTTCTGTCTCCCAGGCTGG - Intergenic
924788209 1:247219850-247219872 GAGGCAACACCCTCCTAGGCAGG + Intergenic
1062854987 10:775608-775630 GAGGCTTCTCTGTGCCAGGCAGG - Intergenic
1062982647 10:1737772-1737794 GAGGCCTCGTCCTCCCGGGCAGG - Intergenic
1064782298 10:18856158-18856180 GAGTCTCCTGTCTCCCAGGCTGG + Intergenic
1064939338 10:20715105-20715127 GAGGTTTCTATCTCCCATGCTGG - Intergenic
1065731094 10:28710376-28710398 CAGCCTTCTGCCTCCCAGCCTGG + Intergenic
1065860302 10:29867076-29867098 GAGTCTTCTATCACCCAGGCTGG + Intergenic
1066673822 10:37866865-37866887 GAGTCTCCTCACACCCAGGCCGG + Intergenic
1067189979 10:44060996-44061018 GAGGCTCCATCCTCTCAGGCAGG - Intergenic
1067750701 10:48969374-48969396 GAGTCCTTTCCCGCCCAGGCTGG - Intronic
1069613903 10:69793957-69793979 GAACCTTCTCCTGCCCAGGCAGG - Intergenic
1069900071 10:71702000-71702022 GGGTCTGCTCCCTCCCGGGCAGG + Intronic
1070245091 10:74723283-74723305 GAGGTTTCACCTCCCCAGGCTGG - Intergenic
1070836495 10:79450253-79450275 TAGGCTCCTCACACCCAGGCTGG - Intergenic
1071271196 10:84009243-84009265 GAGGCTTCCCGCTCCCAGCCTGG + Intergenic
1072352696 10:94573493-94573515 GAGTCTTCTGTCACCCAGGCTGG + Intronic
1074946526 10:118285693-118285715 GGGGCTGCTCTCTCCAAGGCTGG + Intergenic
1075716362 10:124558073-124558095 GCTGCTTCTCCCTCACAGCCTGG - Intronic
1076252768 10:128996839-128996861 CAGGCTTATCCCCCCTAGGCTGG - Intergenic
1076631875 10:131856503-131856525 GAGGTGTCGCCCTCACAGGCTGG + Intergenic
1077184248 11:1229278-1229300 GCTGCTTCTGCCCCCCAGGCAGG + Exonic
1077192486 11:1261225-1261247 GAGGCTTCACCTTCTCAGGATGG - Intronic
1077407515 11:2389206-2389228 GAGGCTCCTCCCTGCTAGACAGG - Intronic
1079079113 11:17401710-17401732 GAGGCATCTCTCTTCCAGTCAGG - Intronic
1081341770 11:41936759-41936781 AAGTCTTCTTCCTCCCAGGTTGG - Intergenic
1081665542 11:44915147-44915169 GAGGCTGCTCCTTGCCAGCCTGG + Intronic
1082005363 11:47416062-47416084 GGGGCTGCTCCCTGCCCGGCAGG - Exonic
1082729701 11:56780221-56780243 GAGTCTCCTGCCACCCAGGCTGG - Intergenic
1082997291 11:59264144-59264166 GAGTCTACTGCCTGCCAGGCAGG - Intergenic
1083025799 11:59549947-59549969 GAGACGGCTCTCTCCCAGGCTGG + Intergenic
1083593375 11:63907899-63907921 GAGGCTGCTCCCCCACAGCCAGG - Intronic
1084674972 11:70629014-70629036 TTGGCGTTTCCCTCCCAGGCTGG - Intronic
1084880972 11:72171671-72171693 GAGACTCCACCCTCCCAGGTGGG + Intergenic
1087624381 11:100580314-100580336 ATGCCTTCTCCATCCCAGGCTGG + Intergenic
1089567419 11:119379036-119379058 GGGGCTTCTCCTTCCCCAGCAGG + Intronic
1089630036 11:119778804-119778826 GAGCCCTCAGCCTCCCAGGCAGG - Intergenic
1089787777 11:120920446-120920468 CAGTCTTCCCTCTCCCAGGCCGG + Intronic
1090260543 11:125315692-125315714 GAAGCTGCCCACTCCCAGGCTGG - Intronic
1090635187 11:128686607-128686629 GAGGCTTCTCCCTCCCAGGCTGG + Intronic
1091621582 12:2093226-2093248 GGGGCCTCTCCTTCCCAGGGAGG + Intronic
1092180436 12:6443130-6443152 GAGCCTTCCCCATCCTAGGCTGG - Intergenic
1096071241 12:48776582-48776604 GGGGCTGCATCCTCCCAGGCTGG - Exonic
1096618552 12:52848237-52848259 GAGGCTTCCCCTGCCCAGGTTGG - Intronic
1096718448 12:53504635-53504657 AAGGCTTCTCACACCCACGCTGG - Intronic
1096919050 12:55064632-55064654 AAGGCTTGACCCTCCCAGGGTGG + Intergenic
1100604170 12:96137511-96137533 GATCCTTCTGCCTCCCAGGTAGG - Intergenic
1100856745 12:98764075-98764097 CATGTTTCTTCCTCCCAGGCAGG - Intronic
1101615197 12:106329400-106329422 GAGACTTCACTCTCACAGGCTGG - Intronic
1101835953 12:108295584-108295606 GAAGCTTCAGACTCCCAGGCTGG - Intronic
1102495286 12:113315258-113315280 GAGTTTTCTTCCACCCAGGCTGG - Intronic
1103240745 12:119411392-119411414 GAGGCTTTTCACCCCCAAGCTGG - Intronic
1104512070 12:129390050-129390072 CAGTCTTCTCCCTCCCCAGCTGG - Intronic
1104965521 12:132507287-132507309 GACGCTTCTCCCTGGCCGGCTGG + Intronic
1105949811 13:25219519-25219541 GAGGCCTCTGCTTCCCAGGAAGG - Intergenic
1106410157 13:29505967-29505989 GAGACCTGTCCCTCTCAGGCTGG + Intergenic
1106721635 13:32440928-32440950 GCGACCTCTGCCTCCCAGGCAGG + Intronic
1108451917 13:50575741-50575763 CAGGACTCTCTCTCCCAGGCTGG + Intronic
1110892463 13:80707734-80707756 GAGGCACCCCCCTCCGAGGCGGG + Intergenic
1112693151 13:101917644-101917666 GAGGCTCCTCCCTCCAACCCGGG - Intronic
1115852776 14:37600444-37600466 TTAGCTTCTCCGTCCCAGGCCGG + Intronic
1117470828 14:56042880-56042902 ATGTCCTCTCCCTCCCAGGCTGG - Intergenic
1119187107 14:72650784-72650806 GAGGCGTCTCCCTCCAAGACAGG + Intronic
1119357294 14:74018149-74018171 GAGTCTTCTGTCACCCAGGCTGG - Intronic
1119642275 14:76324301-76324323 GAGTCTACTCCCTCCCTGCCGGG - Intronic
1119764665 14:77181054-77181076 ACAGCCTCTCCCTCCCAGGCAGG - Intronic
1119852250 14:77874531-77874553 GAGGCCTATGTCTCCCAGGCTGG + Intronic
1121228427 14:92339007-92339029 GTGGCTACTCTCTCCCTGGCTGG + Intronic
1121732359 14:96195376-96195398 AGGGCTTCTCTCTCCCAGGGAGG + Intergenic
1122025020 14:98869383-98869405 GCGGCATCTTCCTCCCAGGAAGG + Intergenic
1122113031 14:99514876-99514898 GTGGCCCCTCCATCCCAGGCAGG + Exonic
1122156556 14:99753556-99753578 GAGGCCCCTCCCTGCCAGGGAGG - Intronic
1122938515 14:104970838-104970860 GAGGCAGGTCCCTCCTAGGCAGG + Intronic
1126042442 15:44604902-44604924 GAGTCTTGTTCCGCCCAGGCTGG - Intronic
1126050679 15:44682298-44682320 TAGGCTTTTCCCTTCCAGCCTGG + Intronic
1129243720 15:74267437-74267459 GAGGCTCCTCACTCCAAGGTTGG + Intronic
1130101940 15:80900850-80900872 TAGGCTTCTCTTCCCCAGGCTGG + Intronic
1130379199 15:83357309-83357331 GTGGCTTCTTCCTGCCAGGGAGG - Intergenic
1130658162 15:85807700-85807722 GAGCCCTCTCTCACCCAGGCTGG - Intergenic
1132702159 16:1226532-1226554 GAAGCTTCTTCCTCCCCAGCAGG - Intergenic
1135667594 16:24349117-24349139 CAGGGTTCTCCCTGCCTGGCTGG + Intronic
1136284633 16:29233740-29233762 GGGGCTCCTCCCTCCCTGGGGGG - Intergenic
1136628456 16:31476073-31476095 GAAGCTGCTGCCTCCCAGGGCGG - Exonic
1136655970 16:31709427-31709449 GAGGCTCATCCTACCCAGGCCGG - Intergenic
1136673274 16:31876772-31876794 CAGGCTTCTGCTTCCCAGTCAGG - Intronic
1136681704 16:31969625-31969647 GAGGCTTCCCACTCACAGGAAGG + Intergenic
1136887779 16:33942725-33942747 GAGGCTTCCCACTCACAGGAAGG - Intergenic
1137392909 16:48096435-48096457 CAGGCTTCTGCCTCCGTGGCTGG + Intronic
1137605298 16:49783173-49783195 GATGTGTCTCCCTGCCAGGCTGG + Intronic
1137735404 16:50719800-50719822 GTGGCTGCTGCCTCCCGGGCAGG + Intronic
1138295418 16:55881103-55881125 GAGGCTTCCTTCTGCCAGGCTGG - Intronic
1138961464 16:62035021-62035043 GAGCCTTCCCCCACCCAGTCTGG - Intronic
1139302047 16:65953764-65953786 AATGCTGCTCCCTCCCGGGCAGG - Intergenic
1139914489 16:70419658-70419680 GAGGCTTCCCTGTCCCAGCCTGG + Intronic
1140442318 16:74997772-74997794 GAGCCTTGCTCCTCCCAGGCTGG - Intronic
1141085996 16:81096087-81096109 GCGGCTGCTCCCTCCCCGCCTGG - Intronic
1141139160 16:81486186-81486208 GAGGCTTTTCCATCACAGCCAGG + Intronic
1141457557 16:84153897-84153919 TAGGCTCCACCCTCCCAGGTGGG + Intronic
1141468351 16:84221895-84221917 GAGGCTTTAACATCCCAGGCTGG - Exonic
1142089654 16:88203208-88203230 GGGGCTCCTCCCTCCCTGGGGGG - Intergenic
1142223171 16:88865146-88865168 CAGGCGTCTCCCTCACATGCTGG - Intronic
1142333972 16:89474934-89474956 GAGGCAGCTCCCGGCCAGGCAGG - Intronic
1203084670 16_KI270728v1_random:1175113-1175135 GAGGCTTCCCACTCACAGGAAGG + Intergenic
1142694872 17:1628142-1628164 GAGACGTCTCCCTGCCTGGCCGG - Exonic
1144288049 17:13798622-13798644 GAGTCTTCTGTCGCCCAGGCTGG - Intergenic
1144800366 17:17922064-17922086 GAGGCCTCTCCCTGCCAGACTGG + Intronic
1145028723 17:19488564-19488586 CTGGCCTCTCCCTCCCAGTCTGG - Intergenic
1145411399 17:22669175-22669197 CAGGCTGCTCTCTCCCAGGAGGG + Intergenic
1145728961 17:27158144-27158166 GGGGCTGCTCTCTCCCAGGAGGG - Intergenic
1145864295 17:28230333-28230355 GAGGAGTCTCACTCCCATGCTGG + Intergenic
1145979544 17:29003688-29003710 GAGGCTCCTCTCTCCTCGGCTGG - Intronic
1146137836 17:30338710-30338732 AAGGTTTCTCCAGCCCAGGCTGG + Intergenic
1146912584 17:36658108-36658130 GGGGCGCCGCCCTCCCAGGCGGG - Intergenic
1148885254 17:50767584-50767606 GAGGCTGCTGCCTCAAAGGCAGG + Intergenic
1148957100 17:51362943-51362965 GAGACTTCTGACTCCCAGCCTGG - Intergenic
1149429770 17:56588456-56588478 GAGGCTTCTGTCTCCAGGGCTGG + Intergenic
1150748664 17:67838669-67838691 GAGGTTTCACCAGCCCAGGCTGG + Intronic
1151549316 17:74812832-74812854 GAGCCTTCTCACTCCAGGGCTGG - Intronic
1151723989 17:75874317-75874339 CAGCCTTCCCTCTCCCAGGCAGG - Exonic
1151759699 17:76093582-76093604 GGGGCTGCTCCCACCCAGGCTGG - Intronic
1152086902 17:78225667-78225689 AAGGCCTTGCCCTCCCAGGCTGG + Intergenic
1152099482 17:78292635-78292657 CAGGCTTCTTGCTCCCAGGGAGG + Intergenic
1152198267 17:78930141-78930163 GTGGCCTCGCCCTCCCAGTCTGG + Intergenic
1152229941 17:79109421-79109443 GAGGCTCCTCCATCCAAGCCTGG + Intronic
1152572934 17:81128419-81128441 GTCCCTTCTGCCTCCCAGGCGGG + Intronic
1152572942 17:81128439-81128461 GGGAGTCCTCCCTCCCAGGCGGG + Intronic
1153337796 18:3942415-3942437 GAAGCTTTCCCCTCCGAGGCTGG - Intronic
1153912302 18:9715051-9715073 GAAGCCTCTCCATCCCAGGCAGG - Intronic
1154962271 18:21321263-21321285 GAGACTTCTGTCGCCCAGGCTGG - Intronic
1155471225 18:26194746-26194768 GAGGCCTCTGTCACCCAGGCTGG + Intergenic
1157163369 18:45335806-45335828 GAGGCTCCTCCTTTCCTGGCTGG - Intronic
1157810266 18:50690103-50690125 AAGGCTTGCCACTCCCAGGCTGG + Intronic
1159409659 18:68054969-68054991 GAGGCCTCTCTCTCCCATTCAGG + Intergenic
1160352549 18:78196390-78196412 GAGGCCTCTTCTTCCCAGGATGG - Intergenic
1162381954 19:10336463-10336485 GAGACTTGACACTCCCAGGCTGG + Intronic
1162721575 19:12665926-12665948 GAGGCCAGGCCCTCCCAGGCAGG + Intronic
1162733199 19:12731261-12731283 CAGCCTTCTCCCTCCCTGTCTGG - Intronic
1162801278 19:13112018-13112040 ATGGGGTCTCCCTCCCAGGCTGG + Intronic
1163610614 19:18299502-18299524 GGGTCCTCTCCCTCCCAGGGTGG - Intergenic
1164053288 19:21601117-21601139 CAGGCTTCTACTTCCCAGTCAGG + Intergenic
1164243561 19:23410953-23410975 CAGGCTTCTACTTCCCAGTCAGG + Intergenic
1164967902 19:32501832-32501854 GAGTCTTCTGTCGCCCAGGCTGG + Intergenic
1165079874 19:33301111-33301133 GTGGCTTCTCCCTGCGAGGAGGG - Exonic
1165323916 19:35103080-35103102 GAGTCTTCTGCCGCCCAGGCTGG + Intergenic
1165353082 19:35287319-35287341 GAGCCCTCTCCCGCCCAGCCTGG - Intergenic
1165674404 19:37708816-37708838 GAGTCTTCTGTCACCCAGGCTGG - Intronic
1165901347 19:39170686-39170708 GGGGCTTCTCCCCGCCAGGCTGG - Intronic
1166333286 19:42090862-42090884 GAGGCTTCTCCGCCCCTGGCTGG + Exonic
1167153282 19:47722442-47722464 GAGGCTGCTTCCTCTCAGGCAGG + Intronic
1167264604 19:48477468-48477490 GGGGCTCCTCCCTCCCAGAGAGG - Intronic
1168114925 19:54217142-54217164 GAGCCTCCTCCATCCCAGGAAGG - Exonic
1168177794 19:54636807-54636829 GAGCCTCCTCCATCCCAGGAAGG + Exonic
1168182064 19:54667948-54667970 GAGCCTCCTCCATCCCAGGAAGG + Exonic
1168697586 19:58413534-58413556 GAGTCTGATGCCTCCCAGGCTGG + Intronic
925669363 2:6294476-6294498 GTGGCTTCTCCTTCCCCTGCAGG + Intergenic
927549624 2:23986635-23986657 GGGTCTTCTGCCACCCAGGCTGG + Intronic
928071466 2:28221771-28221793 GTGACTTCTGCCTCCTAGGCAGG - Intronic
928089326 2:28364376-28364398 CAGGCCTCTCCTTCCCAGGGCGG + Intergenic
928200227 2:29243189-29243211 GAGGTGCCTCCCTCCCAGGGAGG + Intronic
928619017 2:33070365-33070387 GAGGTTTCGCCATCCCAGACGGG - Intronic
929452444 2:42046888-42046910 GCGGCTTATCTCTCCCAGGAGGG + Intergenic
931516212 2:63051898-63051920 GAGGCTTCGACCTCCCAGCTCGG + Intronic
932835543 2:75032416-75032438 GAGGCTTTTGCCACCCAGGGAGG + Intergenic
933773603 2:85758832-85758854 GGGGCTGCTCCCTGCCAGGTGGG + Intronic
934573502 2:95385924-95385946 GAGGGGTCTGCCTCCCACGCTGG + Exonic
935262234 2:101365269-101365291 GAGACTGCTCCTTTCCAGGCTGG + Intronic
936050922 2:109223082-109223104 GATGCTTCTCCATCCCAGACAGG + Intronic
936399628 2:112155590-112155612 GCTGCATCTCCGTCCCAGGCGGG - Intronic
937265966 2:120614831-120614853 CAGGCCTGTCCCGCCCAGGCAGG + Intergenic
938739701 2:134219427-134219449 GATTCTTCTCTCTCCCATGCCGG + Intronic
938783180 2:134603680-134603702 TAGCCTTCACCCTGCCAGGCAGG - Intronic
939503467 2:143014360-143014382 GAGGCTTCTCCTTCCCCAGCAGG + Intronic
943061495 2:183045548-183045570 CAGGCTGCTCCTTGCCAGGCTGG + Intergenic
946197000 2:218039495-218039517 GAGGATTCTTGCTCACAGGCTGG + Intronic
946314111 2:218898160-218898182 GGGGCGCCTCCCACCCAGGCGGG - Intronic
946415602 2:219538335-219538357 GAGGGCTCCCCCTCCCCGGCTGG - Exonic
946660212 2:221991729-221991751 GAGACTTCTCTCTCCCAGGAGGG + Intergenic
946691064 2:222308500-222308522 GAGGAAACTCCCTCCAAGGCAGG + Intergenic
947979255 2:234395343-234395365 GAGGCTTCTCCTTTCCAGTTAGG + Intergenic
948380532 2:237547311-237547333 GGAGCTCCTCCCTCCCAGGCTGG - Intronic
948380549 2:237547385-237547407 GGAGCTCCTCCCTCCCAGGCTGG - Intronic
948380566 2:237547459-237547481 GGAGCTCCTCCCTCCCAGGCTGG - Intronic
948380583 2:237547533-237547555 GGAGCTCCTCCCTCCCAGGCTGG - Intronic
948380599 2:237547607-237547629 GGAGCAACTCCCTCCCAGGCTGG - Intronic
948380616 2:237547681-237547703 GGAGCTCCTCCCTCCCAGGCTGG - Intronic
948380632 2:237547755-237547777 GGAGCAACTCCCTCCCAGGCTGG - Intronic
948380650 2:237547829-237547851 GGAGCAACTCCCTCCCAGGCTGG - Intronic
948488276 2:238295008-238295030 GAGCCTTCACCCTCCCAAGGAGG - Intergenic
1168922832 20:1554716-1554738 GAGGCAGCTCCCTCCCATACCGG + Intronic
1169378969 20:5089984-5090006 GAGTCTTCTGCCACCCAGGGAGG - Intronic
1171078310 20:22151655-22151677 TAGGATTCACCATCCCAGGCAGG + Intergenic
1171463043 20:25309571-25309593 GCCGTTTCTCCCTCCCAGGTTGG - Exonic
1172520240 20:35561251-35561273 CAGGCCCCTCCCTCCCTGGCTGG + Intergenic
1173083847 20:39895672-39895694 GTGGATTGTCCCTCCAAGGCTGG - Intergenic
1174087576 20:48020013-48020035 GAGGCTCCTCCCTCTCCTGCTGG + Intergenic
1174334124 20:49845660-49845682 CCAGCTTCTCCTTCCCAGGCTGG + Intronic
1175772482 20:61632535-61632557 CCGGCTTCCCCCTCCCGGGCTGG + Intronic
1176076472 20:63250595-63250617 GAGGCTGCTCTCTGGCAGGCAGG + Intronic
1176238868 20:64066790-64066812 GAGGCCTCTACCTCCCTGGGAGG + Intronic
1176418289 21:6492847-6492869 GAGGCTTATCCCTTCTAGGGAGG - Intergenic
1178270092 21:31181812-31181834 CAGGCCTCTGTCTCCCAGGCTGG + Intronic
1178936276 21:36865034-36865056 GAGGCTGCTCCGTCTCAGACAGG + Intronic
1179643376 21:42761196-42761218 GCGCCTTCTCCACCCCAGGCAGG + Intronic
1179693782 21:43101169-43101191 GAGGCTTATCCCTTCTAGGGAGG - Intronic
1180972646 22:19823343-19823365 GAGTCTTCCCCATCACAGGCTGG - Intronic
1182435373 22:30326567-30326589 GACACGTCCCCCTCCCAGGCAGG - Intronic
1182830027 22:33297581-33297603 GAGTCTTATGCCGCCCAGGCTGG - Intronic
1183094161 22:35542161-35542183 CTGGCTGCTCCCTCCCAGCCTGG - Intronic
1183524451 22:38315291-38315313 AATCCATCTCCCTCCCAGGCTGG - Intronic
1183829841 22:40411854-40411876 ATGGCTTCTCCTTCCCTGGCAGG + Exonic
1184086726 22:42270208-42270230 GAGGCTCCGCACTCCCAGGTTGG + Intronic
1184194635 22:42918738-42918760 GAGGCTCCAGCCTCCCTGGCAGG - Intronic
1184244678 22:43230074-43230096 GAGTGTGCTCCCTCCCAGGGAGG + Intronic
1184336747 22:43858342-43858364 CAGGCTTTTGCCTCCCAGCCCGG + Intronic
1184776414 22:46625730-46625752 GTGGCCTCTCCCTGCCTGGCTGG + Intronic
953152491 3:40337624-40337646 GAGGCTCCTCCTACCCAGACTGG + Intergenic
953187045 3:40647736-40647758 TAGACTTCTAACTCCCAGGCCGG - Intergenic
954154543 3:48678192-48678214 GAGGCTGCTTCCTCCCTGGCTGG + Intronic
954294696 3:49667792-49667814 GAGGGTTCTCCCTCCCAACAAGG - Exonic
954295848 3:49674194-49674216 AGGACTTCTCGCTCCCAGGCCGG + Exonic
957171122 3:76737941-76737963 GTGGGGTCTCCCACCCAGGCTGG - Intronic
961437877 3:126931886-126931908 GAGGGCTCCCCGTCCCAGGCGGG - Intronic
963225986 3:142862098-142862120 GAGCATACTCCCTGCCAGGCTGG + Intronic
965516893 3:169630950-169630972 GAGGCTTCCCTCTTACAGGCTGG - Intronic
966428340 3:179805087-179805109 GAGGCTTCTGTCACCCAGGCTGG - Intronic
967763367 3:193250718-193250740 GAAGTTTCTCCCTGCCAGGAGGG - Intronic
968279398 3:197464647-197464669 GAGGGCTCTCACACCCAGGCTGG + Intergenic
968747470 4:2367782-2367804 GAGGCCTCACCAGCCCAGGCAGG + Intronic
969706314 4:8794138-8794160 GAGGCCCACCCCTCCCAGGCCGG + Intergenic
969718051 4:8877852-8877874 GGCGCGTCTGCCTCCCAGGCTGG - Intergenic
970652562 4:18194699-18194721 GAGATCTCTCCCTCCCAAGCAGG - Intergenic
971264870 4:25088589-25088611 GAAGCTTCTCCCACGCAGGCAGG + Intergenic
980934315 4:139211738-139211760 GAGTCTTATGCCACCCAGGCTGG - Intergenic
985661013 5:1156421-1156443 GAGGCCTCTGCCTCGCACGCAGG - Intergenic
985902880 5:2810574-2810596 AAGGCTGCTTCCTCCAAGGCTGG + Intergenic
986721765 5:10564999-10565021 GTGGCTTCCCCGTCTCAGGCTGG + Intronic
990344978 5:54863185-54863207 ATGGCTTCTCCCTCAAAGGCTGG - Intergenic
990980836 5:61601251-61601273 GGGGCCCCTCACTCCCAGGCTGG - Intergenic
991473119 5:66990607-66990629 AAGGCTTCTGTCTCCCAGGCTGG - Intronic
991578388 5:68128482-68128504 GAGTCTGCTGTCTCCCAGGCTGG + Intergenic
992850951 5:80807005-80807027 GAGGTCTCCCCATCCCAGGCTGG - Intronic
996994283 5:129676490-129676512 GTGGGTTCTACCTCCCAGTCAGG + Intronic
999275940 5:150330332-150330354 GCACTTTCTCCCTCCCAGGCTGG + Intronic
999744811 5:154584070-154584092 GAAGCACCTGCCTCCCAGGCGGG - Intergenic
1000326422 5:160175819-160175841 GTGGCTGCTCTCTGCCAGGCTGG - Intergenic
1001014286 5:168126606-168126628 GAGGCTTGTCTCTCCTTGGCTGG - Intronic
1001288094 5:170438183-170438205 GTGGCTTCTCCTTCCCACACAGG + Intronic
1001413090 5:171524510-171524532 CAGTGTTCTCTCTCCCAGGCTGG - Intergenic
1003500774 6:6701085-6701107 GAGCCCTCTCCCTACCAGGCAGG - Intergenic
1005806519 6:29478538-29478560 GAGGCCTCTCCACCCCAGGAGGG - Intergenic
1007115251 6:39338884-39338906 GAGCCATCTCCCACCCAGGATGG + Intronic
1007239474 6:40414730-40414752 GAAGCTTGGCCCCCCCAGGCGGG + Intronic
1007741339 6:44011476-44011498 GAGGCATGTCCCTCCCAGGTTGG + Intergenic
1007800203 6:44385802-44385824 AAGGCTTCTCCCTCCCACTCAGG - Intergenic
1013068894 6:106710373-106710395 CACGCTTCTCCCTTCCAGGAGGG - Intergenic
1013147682 6:107410912-107410934 GAGTCTTATGCCGCCCAGGCTGG + Intronic
1013432339 6:110066313-110066335 GTTGCTCCTCCCTCCCTGGCTGG - Intergenic
1015019577 6:128456286-128456308 TGGGCTTCTGCCTCCCTGGCTGG - Intronic
1015562258 6:134529078-134529100 GAGTCTTCTGTCACCCAGGCTGG + Intergenic
1017649065 6:156564587-156564609 AAGGCTGCCCCCTCCAAGGCCGG + Intergenic
1017716421 6:157216873-157216895 CAGGTTGCTCCCTCCCAGCCGGG - Intergenic
1018862937 6:167724492-167724514 GAGGCATCTCCCTCACTGCCAGG - Intergenic
1019594132 7:1850596-1850618 GTGCCTTCTCCGGCCCAGGCCGG - Intronic
1019722776 7:2583505-2583527 CAGGCTTTTCCCTCCCATCCTGG + Intronic
1020748710 7:12111945-12111967 GAGGGTTCTCCCTCTTGGGCAGG - Intergenic
1022603292 7:31782601-31782623 GAGGGTTCTCTCTCTGAGGCCGG + Intronic
1024001953 7:45195552-45195574 GAGTCATCTCCCTCCCATTCAGG - Intergenic
1025245340 7:57312719-57312741 GAGGCTTTCCCCCTCCAGGCTGG + Intergenic
1031444479 7:121834248-121834270 GGGGCTTCTCCCTGTCAGGATGG + Intergenic
1031991396 7:128201410-128201432 GAGGCGCCTCCTTCCCAGGTGGG + Intergenic
1032015686 7:128379149-128379171 GGGGCTGCCCCCTCCCAGGCAGG + Intergenic
1032087866 7:128893156-128893178 GAGGGTGCTCCTTCCCAGGACGG - Intronic
1032486338 7:132290248-132290270 GAGGCTTCTGGCTTCCAGGAAGG + Intronic
1032737847 7:134709473-134709495 GCTGATGCTCCCTCCCAGGCTGG + Intergenic
1034285255 7:149879700-149879722 GAGGGTGCTCCGGCCCAGGCGGG + Exonic
1034680460 7:152924480-152924502 GAGACTCATCCATCCCAGGCTGG - Intergenic
1035642464 8:1194420-1194442 GAGGCTCCTCCTGCCCAGGGCGG + Intergenic
1036671635 8:10792363-10792385 GGGGCATCTCCCTCTCAGGTGGG - Intronic
1036994091 8:13634175-13634197 GAAGCTTCTCCCTTCCAATCTGG + Intergenic
1037916281 8:22775328-22775350 GAGGCTTCTCCCTGGCAGACGGG - Intronic
1038479421 8:27891644-27891666 GAGGCTTCTGCATCCCACGGGGG - Intronic
1038537155 8:28361342-28361364 GAGGAATCTGCCTCCCAGGGAGG + Intronic
1038574772 8:28695500-28695522 GAGGCTTCTCCATCTCTGGTGGG + Intronic
1039111089 8:34041198-34041220 GGGGCATCTAACTCCCAGGCAGG + Intergenic
1041118476 8:54563573-54563595 GGGTCTTGTTCCTCCCAGGCTGG + Intergenic
1042278350 8:67028628-67028650 CAGGCTGCTCCCTCCCCGGTGGG + Intronic
1042769022 8:72358594-72358616 GAGTCTTCTCTCTTCCTGGCTGG - Intergenic
1043312580 8:78879463-78879485 GGGGCTTCTCTCTCACAGTCTGG - Intergenic
1049407965 8:142460148-142460170 GAGCCTTCTCACACCAAGGCAGG - Intronic
1049641397 8:143717595-143717617 GAGGCTCCTCCTTCCCATCCTGG - Intronic
1049750667 8:144282181-144282203 GAGGCAGCTTCCTCCCTGGCTGG + Intronic
1051665649 9:19465000-19465022 GCGGCTTTTGCCTCCCACGCAGG + Intergenic
1052047359 9:23810268-23810290 GAGGCATTTCCATCACAGGCTGG - Intronic
1053441182 9:38117750-38117772 CAGGCTCCTTCATCCCAGGCTGG + Intergenic
1056832995 9:89931595-89931617 GAGGATTCTCCCTCCCACGTAGG - Intergenic
1058057006 9:100458592-100458614 GAAACCTCTGCCTCCCAGGCTGG - Intronic
1058435756 9:104961525-104961547 GAGGTTTCAGACTCCCAGGCAGG - Intergenic
1059166380 9:112080104-112080126 GATGCTTCTCCATCTCAAGCAGG + Exonic
1059332022 9:113541669-113541691 GAGGCTTCTTCCTTCCAAGGAGG + Intronic
1060114666 9:120930442-120930464 GCAGCATCTCCCTCCCAGGTGGG - Intergenic
1060208043 9:121694021-121694043 GAGGCTTCCCACCCCCAGGGAGG - Intronic
1060301139 9:122375236-122375258 GAGGCTCCTCCCTCCCAGTCCGG - Intronic
1060403314 9:123360846-123360868 GATGGCTGTCCCTCCCAGGCAGG + Intronic
1060883752 9:127136301-127136323 CAGGCCTCCCCCTCCCTGGCTGG - Intronic
1061245344 9:129398715-129398737 GAGGCCTCTCCTCCCCAGGAGGG + Intergenic
1061479871 9:130892339-130892361 GATGCTGCTCACTCCCGGGCTGG - Intergenic
1061612781 9:131759303-131759325 AAGGCTGCTACCTCCCAGACAGG + Intergenic
1061841863 9:133363252-133363274 GAGGCTTCCAGCTGCCAGGCTGG + Exonic
1061943909 9:133897873-133897895 GAGGCTGCTGTCTCCCTGGCAGG - Intronic
1062178037 9:135175200-135175222 GTGGCTTCTCCCTGACATGCGGG + Intergenic
1062238825 9:135525254-135525276 GGGGCATCTCCCACCCAGGTAGG - Intronic
1062244694 9:135559577-135559599 GAGGCATCTCCCACCAAGCCTGG + Intergenic
1185761341 X:2691531-2691553 GAGCCTCCTCCCTGCCCGGCAGG + Intronic
1186037198 X:5437215-5437237 GAGACCTCTGTCTCCCAGGCTGG - Intergenic
1187446393 X:19364703-19364725 GAGGCTTCTCCATGTTAGGCTGG - Intronic
1187939474 X:24367792-24367814 GTGGCTCTTTCCTCCCAGGCAGG + Intergenic
1190009218 X:46768928-46768950 GAGTCTTCTGTCACCCAGGCTGG + Intergenic
1192098632 X:68239837-68239859 AAGGAGTCTCACTCCCAGGCTGG + Intronic
1192215228 X:69153419-69153441 TTGACTCCTCCCTCCCAGGCTGG - Intergenic
1192265969 X:69538422-69538444 GTGGCTCCTCCTACCCAGGCTGG + Intergenic
1195564784 X:106327723-106327745 GAGGCTTCTCGCTCCCACCTGGG + Intergenic
1195589870 X:106612105-106612127 GAGGCTGGTCCCTCACATGCAGG + Exonic
1196272062 X:113723833-113723855 GAGTCTTCTGTCACCCAGGCTGG - Intergenic
1198701877 X:139405757-139405779 GGGGCTTCTCACTGCCAGCCTGG - Intergenic
1199776353 X:151015339-151015361 GAGGCTCCTGCCTTCCAGGGAGG - Intergenic
1200927419 Y:8666928-8666950 TAGGTTGCTCCCTCCCAGGTGGG + Intergenic
1202181312 Y:22142285-22142307 GGGGTTTCTCTCTCCCAGGTGGG - Intergenic
1202210048 Y:22444115-22444137 GGGGTTTCTCTCTCCCAGGTGGG + Intergenic