ID: 1090635806

View in Genome Browser
Species Human (GRCh38)
Location 11:128689871-128689893
Sequence TACGTGGGAGGCCGCGGCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3027
Summary {0: 1, 1: 0, 2: 7, 3: 147, 4: 2872}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090635806_1090635819 27 Left 1090635806 11:128689871-128689893 CCGCCGCCGCGGCCTCCCACGTA 0: 1
1: 0
2: 7
3: 147
4: 2872
Right 1090635819 11:128689921-128689943 CAAGAACCAGCGTGGGGAGCGGG 0: 1
1: 0
2: 0
3: 20
4: 223
1090635806_1090635816 20 Left 1090635806 11:128689871-128689893 CCGCCGCCGCGGCCTCCCACGTA 0: 1
1: 0
2: 7
3: 147
4: 2872
Right 1090635816 11:128689914-128689936 GCTAAGGCAAGAACCAGCGTGGG 0: 1
1: 0
2: 0
3: 6
4: 69
1090635806_1090635818 26 Left 1090635806 11:128689871-128689893 CCGCCGCCGCGGCCTCCCACGTA 0: 1
1: 0
2: 7
3: 147
4: 2872
Right 1090635818 11:128689920-128689942 GCAAGAACCAGCGTGGGGAGCGG 0: 1
1: 0
2: 2
3: 18
4: 263
1090635806_1090635812 4 Left 1090635806 11:128689871-128689893 CCGCCGCCGCGGCCTCCCACGTA 0: 1
1: 0
2: 7
3: 147
4: 2872
Right 1090635812 11:128689898-128689920 TCTGAACCCGCTCAGCGCTAAGG 0: 1
1: 0
2: 0
3: 1
4: 40
1090635806_1090635817 21 Left 1090635806 11:128689871-128689893 CCGCCGCCGCGGCCTCCCACGTA 0: 1
1: 0
2: 7
3: 147
4: 2872
Right 1090635817 11:128689915-128689937 CTAAGGCAAGAACCAGCGTGGGG 0: 1
1: 0
2: 0
3: 8
4: 107
1090635806_1090635815 19 Left 1090635806 11:128689871-128689893 CCGCCGCCGCGGCCTCCCACGTA 0: 1
1: 0
2: 7
3: 147
4: 2872
Right 1090635815 11:128689913-128689935 CGCTAAGGCAAGAACCAGCGTGG 0: 1
1: 0
2: 0
3: 2
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090635806 Original CRISPR TACGTGGGAGGCCGCGGCGG CGG (reversed) Intronic
Too many off-targets to display for this crispr