ID: 1090636934

View in Genome Browser
Species Human (GRCh38)
Location 11:128695087-128695109
Sequence TGCAACGGAGGCGGCTCCGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 54}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090636934_1090636943 14 Left 1090636934 11:128695087-128695109 CCTTCGGAGCCGCCTCCGTTGCA 0: 1
1: 0
2: 0
3: 1
4: 54
Right 1090636943 11:128695124-128695146 GCCCGCGCCCCGCGCCCGCCCGG 0: 2
1: 2
2: 22
3: 129
4: 696

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090636934 Original CRISPR TGCAACGGAGGCGGCTCCGA AGG (reversed) Intronic