ID: 1090636934

View in Genome Browser
Species Human (GRCh38)
Location 11:128695087-128695109
Sequence TGCAACGGAGGCGGCTCCGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 54}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090636934_1090636943 14 Left 1090636934 11:128695087-128695109 CCTTCGGAGCCGCCTCCGTTGCA 0: 1
1: 0
2: 0
3: 1
4: 54
Right 1090636943 11:128695124-128695146 GCCCGCGCCCCGCGCCCGCCCGG 0: 2
1: 2
2: 22
3: 129
4: 696

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090636934 Original CRISPR TGCAACGGAGGCGGCTCCGA AGG (reversed) Intronic
901193324 1:7425504-7425526 TGCCATGGAGGCTGCTCTGAAGG - Intronic
906371633 1:45258757-45258779 TGCAAGGGAAGGGGCTCCCAAGG - Intronic
906636975 1:47416385-47416407 GGCGACGGCGGCGGCCCCGACGG - Exonic
915206240 1:154272541-154272563 TGAAATGGAGGCGGGACCGAAGG - Exonic
916872538 1:168932533-168932555 TGCAACAGTGGTGGCTCTGAAGG + Intergenic
924415064 1:243850041-243850063 TGCAACGGCGGCGGCGGCGGTGG + Intronic
1069629945 10:69891533-69891555 TGCAGCGGAGGCAGCTGTGATGG - Intronic
1072282481 10:93879982-93880004 TGCAACAGAGGCACCTCAGATGG + Intergenic
1077176275 11:1192406-1192428 TGCCACGGAGGCGGATACCATGG - Intronic
1078210382 11:9265288-9265310 TGCAGCGGCGGCGGCGCGGAGGG - Exonic
1081899956 11:46619223-46619245 TGCAAAGGAGGCTGCCCAGAGGG + Intronic
1088550811 11:111010625-111010647 TGCTAAGGAGGCAGCTCCCATGG + Intergenic
1090636934 11:128695087-128695109 TGCAACGGAGGCGGCTCCGAAGG - Intronic
1097063065 12:56300277-56300299 TGCACCAGAGGCCGCGCCGACGG + Exonic
1104708504 12:130967689-130967711 AGCAACAGAGGCAGCACCGATGG - Intronic
1104761059 12:131297780-131297802 TGCAGCGGTGGCGGTTCAGAGGG + Intergenic
1104818718 12:131663012-131663034 TGCAGCGGTGGCGGTTCAGAGGG - Intergenic
1105801058 13:23903650-23903672 TGCACCGCGGGCGGCCCCGACGG + Intergenic
1105830647 13:24160854-24160876 GGCACCGGAGGTGGCTCTGAGGG + Intronic
1105847811 13:24308307-24308329 TGCACCGCAGGCGGCCCCGACGG - Intronic
1106436207 13:29725000-29725022 TGCAAAGGAGGCTCCTCAGATGG + Intergenic
1122440299 14:101727151-101727173 TGCAACGGAGGATGCTCCAGGGG - Intergenic
1122802555 14:104238951-104238973 TGCACCGGAGGAGCCTCTGATGG + Intergenic
1125721628 15:41847829-41847851 TGCAGCGGAGGCGGCAGCGCAGG + Exonic
1130335245 15:82952545-82952567 TGCTCCGGCGGCCGCTCCGACGG + Exonic
1134168447 16:11949034-11949056 TGTAAGGGAGGCGGCTGAGATGG + Intronic
1135640739 16:24117885-24117907 TGCAACGGAAGGGGAGCCGACGG - Intronic
1137748529 16:50841380-50841402 TACAGCGGAGGCGGCCCCCACGG - Intergenic
1140900046 16:79358860-79358882 TGCTGCAGAGGCTGCTCCGATGG + Intergenic
1142254661 16:89007896-89007918 TGCACAGGATGAGGCTCCGATGG + Intergenic
1148371053 17:47100156-47100178 GGCAGAGGAGGCGGCCCCGAGGG - Intergenic
1150633801 17:66898718-66898740 TGCAGCTGAGGCAGCTCCCAGGG - Intergenic
1160243648 18:77140418-77140440 TGTATCGGAGGGGGCTCTGAGGG - Intergenic
1167427358 19:49436363-49436385 GGAAACGGAGGCGGCCCCTAAGG + Intronic
933858402 2:86441302-86441324 AGCGGCGGAAGCGGCTCCGAGGG + Exonic
935150131 2:100426657-100426679 GGCCACGGAGGCTGCTCAGATGG - Intergenic
1170402445 20:16002949-16002971 TGCAACTGAGGAGACTCAGAAGG - Intronic
954210411 3:49093930-49093952 TGCAGCGGAGGCGGCGGCGGCGG - Exonic
960801572 3:121545666-121545688 GGCAACGGGGGCAGCTCCGCCGG - Intronic
960955138 3:123026522-123026544 GGCAAAGGAGTCGGCTCCGTTGG + Intronic
969278105 4:6150555-6150577 TGCCTCGGAGGCAGCTCCCACGG + Intronic
972333586 4:38085588-38085610 TGCAGCGGAGGCTGAGCCGAAGG - Intronic
981331403 4:143514018-143514040 AGCAACAAAGGCGGCCCCGAAGG + Exonic
983608071 4:169612651-169612673 CGCAGCGGAGGCGGCTGGGAAGG + Intronic
984023999 4:174521843-174521865 GGCAGCGGAGGCGGCACCCAGGG + Intronic
987379879 5:17275447-17275469 TGCCAAGGAGGAGGCCCCGAAGG + Exonic
1002158781 5:177303054-177303076 GGCCACGAAGGCGGCCCCGATGG + Exonic
1004044712 6:12012529-12012551 TGCAGCGGCAGCGGCTCCGCCGG + Exonic
1034264177 7:149773307-149773329 TGCAAGGGAGGAGGGACCGAGGG + Exonic
1036210144 8:6834840-6834862 TGCGACGGAGGTGGCCTCGAAGG + Intronic
1041894515 8:62908081-62908103 TGCAAGGGAGGGGGTTCCCATGG - Intronic
1042241295 8:66666924-66666946 GGCAACGGAGGCGGCGGCGGCGG + Exonic
1054905940 9:70413669-70413691 TCCAAGGGAGCCGGCTCAGAGGG - Exonic
1059299786 9:113303061-113303083 GGCGGAGGAGGCGGCTCCGAGGG - Intronic
1061714494 9:132510216-132510238 TGCAACCTGGGAGGCTCCGAGGG - Intronic
1062289007 9:135786269-135786291 GGCACCGGAGGCAGCTCCCAGGG + Exonic