ID: 1090636943

View in Genome Browser
Species Human (GRCh38)
Location 11:128695124-128695146
Sequence GCCCGCGCCCCGCGCCCGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 851
Summary {0: 2, 1: 2, 2: 22, 3: 129, 4: 696}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090636939_1090636943 5 Left 1090636939 11:128695096-128695118 CCGCCTCCGTTGCAGGGGCCGGC 0: 1
1: 0
2: 0
3: 6
4: 97
Right 1090636943 11:128695124-128695146 GCCCGCGCCCCGCGCCCGCCCGG 0: 2
1: 2
2: 22
3: 129
4: 696
1090636941_1090636943 -1 Left 1090636941 11:128695102-128695124 CCGTTGCAGGGGCCGGCTGTGAG 0: 1
1: 0
2: 0
3: 18
4: 158
Right 1090636943 11:128695124-128695146 GCCCGCGCCCCGCGCCCGCCCGG 0: 2
1: 2
2: 22
3: 129
4: 696
1090636933_1090636943 21 Left 1090636933 11:128695080-128695102 CCTGCGTCCTTCGGAGCCGCCTC 0: 1
1: 0
2: 0
3: 11
4: 83
Right 1090636943 11:128695124-128695146 GCCCGCGCCCCGCGCCCGCCCGG 0: 2
1: 2
2: 22
3: 129
4: 696
1090636940_1090636943 2 Left 1090636940 11:128695099-128695121 CCTCCGTTGCAGGGGCCGGCTGT 0: 1
1: 0
2: 0
3: 8
4: 52
Right 1090636943 11:128695124-128695146 GCCCGCGCCCCGCGCCCGCCCGG 0: 2
1: 2
2: 22
3: 129
4: 696
1090636934_1090636943 14 Left 1090636934 11:128695087-128695109 CCTTCGGAGCCGCCTCCGTTGCA 0: 1
1: 0
2: 0
3: 1
4: 54
Right 1090636943 11:128695124-128695146 GCCCGCGCCCCGCGCCCGCCCGG 0: 2
1: 2
2: 22
3: 129
4: 696

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090636943 Original CRISPR GCCCGCGCCCCGCGCCCGCC CGG Intronic