ID: 1090637632

View in Genome Browser
Species Human (GRCh38)
Location 11:128700891-128700913
Sequence GTCTTGTAACATGTATAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 137}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090637628_1090637632 3 Left 1090637628 11:128700865-128700887 CCTGCCTCAAAATAATAATAACT 0: 1
1: 1
2: 48
3: 473
4: 1805
Right 1090637632 11:128700891-128700913 GTCTTGTAACATGTATAGAAAGG 0: 1
1: 0
2: 1
3: 9
4: 137
1090637630_1090637632 -1 Left 1090637630 11:128700869-128700891 CCTCAAAATAATAATAACTTGGG 0: 1
1: 0
2: 6
3: 40
4: 424
Right 1090637632 11:128700891-128700913 GTCTTGTAACATGTATAGAAAGG 0: 1
1: 0
2: 1
3: 9
4: 137
1090637627_1090637632 23 Left 1090637627 11:128700845-128700867 CCTAGATGACAAAGTGAATACCT 0: 1
1: 0
2: 0
3: 59
4: 904
Right 1090637632 11:128700891-128700913 GTCTTGTAACATGTATAGAAAGG 0: 1
1: 0
2: 1
3: 9
4: 137
1090637626_1090637632 24 Left 1090637626 11:128700844-128700866 CCCTAGATGACAAAGTGAATACC 0: 1
1: 0
2: 0
3: 30
4: 223
Right 1090637632 11:128700891-128700913 GTCTTGTAACATGTATAGAAAGG 0: 1
1: 0
2: 1
3: 9
4: 137
1090637625_1090637632 27 Left 1090637625 11:128700841-128700863 CCACCCTAGATGACAAAGTGAAT 0: 1
1: 0
2: 0
3: 111
4: 1549
Right 1090637632 11:128700891-128700913 GTCTTGTAACATGTATAGAAAGG 0: 1
1: 0
2: 1
3: 9
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090637632 Original CRISPR GTCTTGTAACATGTATAGAA AGG Intronic
907012907 1:50979398-50979420 GTCTTTTAACATGAAAATAATGG + Intergenic
908245781 1:62226813-62226835 GTCTTGAAGCATGAATAGGAAGG - Intergenic
909219227 1:72933165-72933187 GTCTTGTGAGCTGTATACAAAGG - Intergenic
910971902 1:92864523-92864545 GTCCTGAGAAATGTATAGAAGGG + Intronic
911381244 1:97117552-97117574 TTCTTGCAATATGTATACAATGG - Intronic
912079546 1:105918001-105918023 ATCTTGCTACATGTATATAATGG + Intergenic
913218893 1:116643712-116643734 GTGTTGTCACAGGTGTAGAAAGG + Intronic
914890729 1:151620419-151620441 GTCTTGTACTATATAAAGAAGGG + Intronic
919080687 1:192862240-192862262 AACTTGTAACATGTTTAGACTGG - Intergenic
919557597 1:199078796-199078818 GTGTTGTAACATGTATTAATAGG - Intergenic
920740622 1:208578077-208578099 GCTTTGTCACATATATAGAATGG + Intergenic
923412187 1:233721616-233721638 CTATTTTAACATGTATAGCATGG + Intergenic
1066539889 10:36434817-36434839 GTATTGTGACAAGTATATAAAGG + Intergenic
1069116782 10:64516856-64516878 GTCTTGTCACAAGTAAACAAGGG + Intergenic
1069992038 10:72321999-72322021 GTCTGGTCACATGGCTAGAAAGG + Intergenic
1070077159 10:73147704-73147726 GTCTTCCAAGAGGTATAGAAAGG - Intronic
1073638015 10:105219323-105219345 GAGTTGTAACATGTATAAAAAGG + Intronic
1074812884 10:117123317-117123339 GTCTAGTCACAGGTAGAGAACGG - Intronic
1082614833 11:55346984-55347006 GTCTTAAAACATGTATACATTGG + Intergenic
1085753661 11:79185951-79185973 GGCATTTTACATGTATAGAAGGG + Intronic
1085765191 11:79276364-79276386 GTCTTCTAACCTGCACAGAAGGG + Intronic
1085977754 11:81680232-81680254 GTTTTGTTACATGGATATAATGG - Intergenic
1086111828 11:83207676-83207698 GTTTTGTAACCTATATAAAAGGG - Intronic
1086512491 11:87574381-87574403 CTCTTGTAACATCTTTATAATGG - Intergenic
1087428458 11:98019638-98019660 GTTTTATATCATGTATAGCAAGG - Intergenic
1090637632 11:128700891-128700913 GTCTTGTAACATGTATAGAAAGG + Intronic
1093410343 12:18857889-18857911 CTCTAATAAAATGTATAGAAAGG - Intergenic
1093956676 12:25228444-25228466 GTGTTGTAGCATGTATATACAGG - Intronic
1095430137 12:42125242-42125264 GTTTTGTATCATGTTTACAACGG - Intronic
1095489617 12:42719538-42719560 GTCTTGCCAAATGTATATAAAGG - Intergenic
1099575802 12:84380156-84380178 GTATTCTCACATATATAGAAAGG + Intergenic
1100515268 12:95321423-95321445 ATAGTGTAACATGAATAGAAAGG - Intergenic
1101038090 12:100725173-100725195 GGCTTGTAATATGTTTTGAAAGG + Intronic
1101639151 12:106573781-106573803 TTCTTGTAACATTTATTGTAAGG - Intronic
1105914889 13:24904980-24905002 GTCTTTTCATTTGTATAGAAAGG + Intronic
1108576518 13:51796034-51796056 GTTTTTTAACATGTATTTAAGGG - Intronic
1109212945 13:59555837-59555859 GTTTTGATACATGTATAAAATGG - Intergenic
1109477595 13:62903170-62903192 TTCTTCCAAAATGTATAGAATGG - Intergenic
1111850146 13:93562935-93562957 GTTTGGTAACAGGTATAGACTGG - Intronic
1112613641 13:100981097-100981119 GGCTAGAAACATGTATTGAAGGG - Intergenic
1113542569 13:111120722-111120744 CTCTTTTAAGATGTATAGAAAGG - Intronic
1116394950 14:44436502-44436524 TTCCTGTAAAGTGTATAGAAGGG - Intergenic
1117539703 14:56734667-56734689 GTCTGGGAACAAGTACAGAAGGG + Intergenic
1118407208 14:65437105-65437127 TTCTTGTCACATCTATAAAAAGG - Intronic
1118964348 14:70566207-70566229 GTCTTTTAACATTTATATTAGGG - Intergenic
1120520739 14:85525498-85525520 ATCTTGTAACCTGCACAGAAAGG + Intergenic
1121731816 14:96192704-96192726 GACTTGTAACATGGAAAGATGGG + Intergenic
1122106263 14:99458629-99458651 GTCTTGTAACATTTAAAGTCAGG + Intronic
1123126524 14:105950674-105950696 GTTTTGTAACATGTCTACATAGG + Intergenic
1123407038 15:20026777-20026799 GTTTTGTAACATGTCTACATAGG + Intergenic
1123516369 15:21033433-21033455 GTTTTGTAACATGTCTACATAGG + Intergenic
1124271045 15:28281001-28281023 GTTTTGTAACATGAAAATAATGG - Intronic
1124459543 15:29876652-29876674 GTCTTGCATCATGTAGAGCAGGG - Intronic
1126509569 15:49453735-49453757 CTCTTGTTACATGTATCTAATGG + Intronic
1130787049 15:87110625-87110647 ATCTTGTTACATGCATAGAATGG - Intergenic
1131454131 15:92570242-92570264 GGCTTCTGACATGTACAGAATGG - Intergenic
1140304899 16:73793995-73794017 GTCATGTAACATGTGAATAATGG - Intergenic
1141326498 16:83064775-83064797 GTTTTGATACATGTATAAAATGG + Intronic
1145037477 17:19551428-19551450 AACTTGTAACATATAAAGAAAGG - Exonic
1149236585 17:54598053-54598075 GTCTTTTAACATTTATACCACGG + Intergenic
1151065950 17:71150078-71150100 GTTTTGTAAAATGTATGCAATGG - Intergenic
1153212977 18:2788510-2788532 GTCTGGAAAAATATATAGAAAGG - Intronic
1155186900 18:23395006-23395028 GTCCTGTAACTTTTATAAAATGG - Intronic
1155362880 18:25019429-25019451 GTCTGGTAACATGTATACAGGGG - Intergenic
1155448046 18:25933437-25933459 ATTTTGTTACATGCATAGAATGG + Intergenic
1155575219 18:27238374-27238396 GTTTTGTTACATGGATATAATGG + Intergenic
1158115626 18:53992120-53992142 GTTTTGTAATATGTATACACTGG - Intergenic
1159547487 18:69858253-69858275 GCCTTGAAACATTTATAAAAGGG + Exonic
1159890060 18:73944428-73944450 GTCTGGATACATGTATAGATAGG + Intergenic
1159995885 18:74963514-74963536 GTTTTGTAACATGTAAAACATGG - Intronic
1162608942 19:11734363-11734385 GTCTTGTTACAGGTTTAAAAAGG - Intronic
928008611 2:27585848-27585870 TTCTTGTTATATGTATGGAAAGG + Intronic
929351625 2:40963311-40963333 ATTTTGTTACATGCATAGAATGG + Intergenic
938586102 2:132691993-132692015 GTTTTGTAAGAGGTAAAGAAAGG - Intronic
938864769 2:135406894-135406916 GTCTTGTGCCATGTTTTGAAGGG - Intronic
939371213 2:141303192-141303214 ATTTTGTTACATGCATAGAATGG + Intronic
939445596 2:142306105-142306127 TTCTTGTCACATATATACAAAGG + Intergenic
941612501 2:167678529-167678551 GTATTGTAAGATGTATAAGATGG - Intergenic
943990575 2:194685693-194685715 GAATTCTGACATGTATAGAAAGG + Intergenic
944382448 2:199127226-199127248 GTCTTGTAACATATATTCACAGG - Intergenic
945499970 2:210559939-210559961 TTCTACTAAAATGTATAGAATGG - Intronic
1177241294 21:18461499-18461521 ATCTTGTAGCATGAATAGCAAGG + Intronic
1177848139 21:26315664-26315686 GCCTTGGAGCATCTATAGAAGGG - Intergenic
1180820191 22:18821767-18821789 GTGTTGTCACAGGTGTAGAAAGG + Intergenic
1181206414 22:21256239-21256261 GTGTTGTCACAGGTGTAGAAAGG + Intergenic
1203220506 22_KI270731v1_random:39184-39206 GTGTTGTCACAGGTGTAGAAAGG - Intergenic
1203270318 22_KI270734v1_random:47638-47660 GTGTTGTCACAGGTGTAGAAAGG + Intergenic
949324828 3:2851665-2851687 GTTTTCTCACATGTAAAGAAGGG - Intronic
949375247 3:3381957-3381979 GAATTATAACATGTATATAATGG - Intergenic
951333812 3:21397312-21397334 TTCTTGTAGCAGGTATTGAAAGG + Intergenic
952275733 3:31874325-31874347 GTTTTGTATCATATTTAGAAAGG - Intronic
959441874 3:106386586-106386608 ATCTTGTAGCATGAATAGCAAGG + Intergenic
959529827 3:107421795-107421817 TTCTTGTAAAATGTATAAATGGG - Intergenic
964799686 3:160541909-160541931 GTCAAGTAACATGTTTAGAATGG - Intronic
967676453 3:192304636-192304658 GTGTTATAACATGTAAAGTATGG - Intronic
972354344 4:38266496-38266518 GTTTTGAAACATGTACTGAATGG - Intergenic
975107700 4:70587170-70587192 TTGTTGTATTATGTATAGAAAGG + Intergenic
975796496 4:78011963-78011985 GAATTGTAACATGTTTAAAAGGG + Intergenic
976376143 4:84347419-84347441 GTCTTGAACCATGTTTAGAGAGG + Intergenic
977959358 4:103068298-103068320 GCCTTGTAGCCTGTATAGCATGG - Intronic
978120544 4:105073934-105073956 GTCTTATAAAATGTATTGAGTGG - Intergenic
979143404 4:117207631-117207653 GTCTTGCAACATGTAGCAAAAGG - Intergenic
981046684 4:140271234-140271256 GTCTTGAAAGTTGGATAGAATGG + Intronic
982440577 4:155431361-155431383 GTTGTGTAACATGCATTGAAAGG + Intergenic
988733649 5:33998706-33998728 GTCCTGTAAGTCGTATAGAAAGG + Exonic
991556299 5:67898338-67898360 GTCTTGGAAAGTGTATAGAAAGG - Intergenic
993090279 5:83417339-83417361 GTTTTGTAACTTGTACATAATGG - Intergenic
993246258 5:85457293-85457315 GTCTTGTATCATGTCTTGCAGGG + Intergenic
996008575 5:118454238-118454260 GTTTTCTAAAATGAATAGAATGG + Intergenic
996487103 5:124049375-124049397 ATCTTGTAACATGTATATACAGG - Intergenic
998505876 5:142672054-142672076 GTCTTTTAACTTGTATGTAATGG - Intronic
1004347866 6:14865200-14865222 GTCTTCTATCCTGTACAGAAAGG + Intergenic
1005836186 6:29711246-29711268 GTCCTGGAACATGTAGAGGATGG + Intergenic
1005856953 6:29870006-29870028 GCCCTGGAACATGTAGAGAATGG + Intergenic
1008862402 6:56164981-56165003 GAGTAGTAACATGTATAGATAGG - Intronic
1015068389 6:129058780-129058802 GTATTTTAACATGCATAGCATGG + Intronic
1015230173 6:130905728-130905750 GTCTTTAAATATGTATAGAATGG - Intronic
1016695596 6:146991187-146991209 ATCTTGTAACAGGTATAGTCTGG + Intergenic
1017533413 6:155320673-155320695 GTATTGTAACAAGTATAATATGG + Intergenic
1018297396 6:162363778-162363800 GTCCAGCAAGATGTATAGAAGGG - Intronic
1020757155 7:12216886-12216908 GACGTGTAGCATGTATAGAGTGG + Intronic
1020950718 7:14673234-14673256 GAATTATAAAATGTATAGAATGG - Intronic
1022170587 7:27825132-27825154 TTCTTTTAAGATGTATAGTAAGG + Intronic
1022314544 7:29233265-29233287 GTCATGTAATATGCCTAGAATGG + Intronic
1022400525 7:30032055-30032077 ATCTTCTAACATCTAAAGAAAGG - Intronic
1023959959 7:44918205-44918227 ATTTTGTTACATGTATAGAATGG + Intergenic
1024936255 7:54714888-54714910 GTCTTGTACCATGTGTGGGACGG + Intergenic
1028292871 7:89089262-89089284 GTCTTGTTACATCAAGAGAATGG - Intronic
1032611706 7:133422390-133422412 AGCTTGTATCATGTATAAAAAGG + Intronic
1034018347 7:147611286-147611308 GTCTTCTAACCTGTGTAGCAAGG - Intronic
1037612091 8:20484343-20484365 GTCTTGAGACCTGAATAGAATGG - Intergenic
1039800540 8:40950930-40950952 GTTTTGTAAAATATATCGAAAGG - Intergenic
1040440957 8:47441689-47441711 GTTTTGTATCATAGATAGAAAGG + Intronic
1042276212 8:67007743-67007765 GGTTGGTAGCATGTATAGAATGG - Intronic
1046799356 8:118408193-118408215 CTTTTGTAGCATGTATACAAGGG - Intronic
1048550399 8:135428083-135428105 GGCTTGTATCATGTTTAGGAGGG + Intergenic
1050939946 9:11445763-11445785 CTCATGTAACATGTCTAGATGGG + Intergenic
1051078635 9:13270812-13270834 GAATTGTAACATATACAGAATGG + Intronic
1051078905 9:13273540-13273562 GAATTGTAACATATACAGAATGG - Intronic
1052672030 9:31570404-31570426 ATTTTCTCACATGTATAGAATGG + Intergenic
1055847598 9:80585892-80585914 CACTTATAAAATGTATAGAATGG - Intergenic
1059816872 9:117926568-117926590 GTCTTATAAAATCTATATAATGG + Intergenic
1186426910 X:9469663-9469685 GTCTTGACACATGCATAGATTGG + Intronic
1189587083 X:42473313-42473335 GTATTTTAACATGTATAGAATGG + Intergenic
1189633979 X:42985487-42985509 TTATTTTAACATGTATAGCATGG + Intergenic
1190631083 X:52387089-52387111 GCCTTGTATCATTTAAAGAAAGG - Intergenic
1194926090 X:99825988-99826010 TTCTTATAACATGTATTGACTGG - Intergenic
1200857401 Y:7954049-7954071 TTTTAATAACATGTATAGAAGGG + Intergenic