ID: 1090640686

View in Genome Browser
Species Human (GRCh38)
Location 11:128726554-128726576
Sequence CCATTGGTATGGAGCTTAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 60}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090640686_1090640695 15 Left 1090640686 11:128726554-128726576 CCGCCTAAGCTCCATACCAATGG 0: 1
1: 0
2: 1
3: 5
4: 60
Right 1090640695 11:128726592-128726614 AAGTGGATACTTGAGTCACTTGG 0: 1
1: 0
2: 0
3: 19
4: 1396
1090640686_1090640692 -2 Left 1090640686 11:128726554-128726576 CCGCCTAAGCTCCATACCAATGG 0: 1
1: 0
2: 1
3: 5
4: 60
Right 1090640692 11:128726575-128726597 GGCCTCTGGCCAGAACAAAGTGG 0: 1
1: 0
2: 0
3: 15
4: 199
1090640686_1090640696 27 Left 1090640686 11:128726554-128726576 CCGCCTAAGCTCCATACCAATGG 0: 1
1: 0
2: 1
3: 5
4: 60
Right 1090640696 11:128726604-128726626 GAGTCACTTGGCTAGATAGTTGG 0: 1
1: 0
2: 0
3: 8
4: 104
1090640686_1090640697 28 Left 1090640686 11:128726554-128726576 CCGCCTAAGCTCCATACCAATGG 0: 1
1: 0
2: 1
3: 5
4: 60
Right 1090640697 11:128726605-128726627 AGTCACTTGGCTAGATAGTTGGG 0: 1
1: 0
2: 0
3: 15
4: 270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090640686 Original CRISPR CCATTGGTATGGAGCTTAGG CGG (reversed) Intronic
903056897 1:20642207-20642229 CCATTGTTATGCAGCAAAGGGGG + Intronic
904134034 1:28297160-28297182 CCTTTGGAATAGAGGTTAGGAGG + Intergenic
908558351 1:65280678-65280700 CCATTGGCCTGGAAGTTAGGAGG + Intronic
914226551 1:145724029-145724051 ACATTGTTACGGAGCTTTGGGGG - Intronic
917567627 1:176229499-176229521 CCATTGGTGTGGAGCACAGAGGG + Intergenic
918242213 1:182630516-182630538 CCATGGATATGGGGCTCAGGAGG + Intergenic
1063342634 10:5282512-5282534 GCTTTGGTCTGGAGCTCAGGGGG - Intergenic
1063920574 10:10928187-10928209 ACATTGTTCTGGAGCTAAGGGGG - Intergenic
1067707894 10:48624545-48624567 ACATTGGGATGGAGCTTAAATGG - Intronic
1068314284 10:55320895-55320917 CCATTGGTATGGAACTAGTGTGG - Intronic
1068601604 10:58963083-58963105 CCATTGGTATAGAGGAAAGGTGG - Intergenic
1073715260 10:106099043-106099065 CCATTGCTAAGGAACTTAGGGGG + Intergenic
1077038170 11:505293-505315 CCACAGGTTTGGAGATTAGGAGG - Intronic
1082005004 11:47414532-47414554 GCATGGGTGTGGAGCTCAGGAGG + Intronic
1085964890 11:81510782-81510804 CCATTAGCATTGAACTTAGGAGG + Intergenic
1090640686 11:128726554-128726576 CCATTGGTATGGAGCTTAGGCGG - Intronic
1103581449 12:121918564-121918586 CCATGGGGACGGAGCTTGGGTGG + Exonic
1106487535 13:30185538-30185560 CCATTGGTGTTTAGCTTAAGGGG + Intergenic
1112652869 13:101417182-101417204 CCCTGGGCATGGTGCTTAGGAGG - Intergenic
1124616371 15:31245251-31245273 CTATTGGTCTGGTGCTCAGGAGG - Intergenic
1125157134 15:36600561-36600583 TCATTGATATGGTGATTAGGTGG + Intronic
1130303700 15:82699248-82699270 CCAGTGGACTGGAACTTAGGTGG - Intronic
1133660956 16:7917063-7917085 CCATTGGCATTGAGCTTTGGTGG - Intergenic
1134328079 16:13225386-13225408 CAATAGGTATGGAGCAGAGGAGG + Intronic
1137806536 16:51311577-51311599 CCATTGGCAAGGAACTGAGGTGG + Intergenic
1144508092 17:15850614-15850636 TCATTGGTATTTCGCTTAGGGGG - Intergenic
1147998845 17:44375972-44375994 CCATTGTTGTGGAGCTGAAGGGG + Exonic
1148236927 17:45975200-45975222 CCATTGGTTTGGTGATTTGGAGG + Intronic
1149495494 17:57114758-57114780 CCATTGTTATGGAGCTGGGGTGG + Intronic
1155028395 18:21962934-21962956 TCCTTGGTATGGGGCCTAGGAGG + Intergenic
1162094524 19:8302661-8302683 CCATGTGTATGGAGCTTGGTGGG - Intronic
927491722 2:23525562-23525584 GCAGTGGGATGGAGCTAAGGGGG + Intronic
933794276 2:85907166-85907188 CCAGTGGAATGGAGTTGAGGAGG + Intergenic
935944149 2:108270663-108270685 CCATCAGTTTGGAGCTTAGGCGG - Intergenic
939672846 2:145034848-145034870 CCATTGGTATGGAGTTTTGGTGG - Intergenic
946634243 2:221707022-221707044 AAATTGGTAGGGAGATTAGGGGG - Intergenic
1174600164 20:51718009-51718031 TCATTGGTATGCATGTTAGGAGG - Intronic
1176989609 21:15479583-15479605 CCATTGGCATGCAGCATAGAAGG - Intergenic
1181746992 22:24962388-24962410 GGATTGGCATGGAGCTGAGGGGG + Intronic
1184509903 22:44927282-44927304 CCGTTGGTTTGGAGTTTTGGGGG - Intronic
1185399310 22:50607761-50607783 CCATGGGTCTGGAGTTTAGGAGG + Intronic
953007723 3:38993760-38993782 CCAGTGCTGTGGAACTTAGGTGG - Intergenic
962386291 3:134935150-134935172 GCACTGGGATGGAGCTGAGGAGG + Intronic
963078788 3:141372199-141372221 ACATTAGGATGGAGCTGAGGAGG + Intronic
966830733 3:184006132-184006154 CGATTGGTGTGGAGCCCAGGTGG - Intronic
967096065 3:186178316-186178338 GCTGTGGGATGGAGCTTAGGTGG + Intronic
967912872 3:194556474-194556496 CCATTGCTAGGGAGCACAGGAGG - Intergenic
971061136 4:22971275-22971297 CCATTCTAATGGAGCTTAGTAGG - Intergenic
974908237 4:68083071-68083093 TCATGGGTATGCAGCTTATGTGG - Intronic
979805511 4:124965639-124965661 ACATAGATTTGGAGCTTAGGTGG + Intergenic
993831763 5:92768973-92768995 CTAATGGAAAGGAGCTTAGGTGG - Intergenic
1000064096 5:157680389-157680411 CCAGTGGTAAGGAGGTCAGGGGG + Intergenic
1001495304 5:172184101-172184123 CAATTGGCAGGGAGCTGAGGAGG - Intronic
1004464431 6:15871272-15871294 CCATTTGTATGGAGCTCTAGGGG + Intergenic
1005181882 6:23115554-23115576 CCCTTGGTATGGAGAGTACGTGG - Intergenic
1007993559 6:46282646-46282668 CCACTGATCTAGAGCTTAGGAGG + Intronic
1019276647 7:179430-179452 TCCTTGGGAAGGAGCTTAGGCGG + Intergenic
1022514824 7:30968931-30968953 CCCTGGGTATGGGGCCTAGGAGG + Exonic
1031180106 7:118403199-118403221 CCATAGGTATGGATCTCAAGGGG + Intergenic
1032773970 7:135090745-135090767 CCCTTAGGGTGGAGCTTAGGTGG - Intronic
1044335186 8:90974387-90974409 CCATTGGCTTGGAGCTCAGCTGG - Intronic
1049707746 8:144050690-144050712 CCCTGGGTATCGTGCTTAGGGGG + Intergenic
1055661811 9:78511386-78511408 CCATTGGTATGGAGAGGAAGCGG + Intergenic
1193769512 X:85572244-85572266 CCATTGCTAGGGAGCTAATGTGG - Intergenic
1195671596 X:107474582-107474604 TCATTGGTAGGGGGTTTAGGAGG + Intergenic
1202342955 Y:23888696-23888718 CCAGGGGTCTGGAGCATAGGAGG - Intergenic
1202527813 Y:25781389-25781411 CCAGGGGTCTGGAGCATAGGAGG + Intergenic