ID: 1090640692

View in Genome Browser
Species Human (GRCh38)
Location 11:128726575-128726597
Sequence GGCCTCTGGCCAGAACAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 199}

Found 20 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090640681_1090640692 5 Left 1090640681 11:128726547-128726569 CCCACCCCCGCCTAAGCTCCATA 0: 1
1: 0
2: 0
3: 6
4: 113
Right 1090640692 11:128726575-128726597 GGCCTCTGGCCAGAACAAAGTGG 0: 1
1: 0
2: 0
3: 15
4: 199
1090640678_1090640692 11 Left 1090640678 11:128726541-128726563 CCTACCCCCACCCCCGCCTAAGC 0: 1
1: 0
2: 13
3: 139
4: 1451
Right 1090640692 11:128726575-128726597 GGCCTCTGGCCAGAACAAAGTGG 0: 1
1: 0
2: 0
3: 15
4: 199
1090640686_1090640692 -2 Left 1090640686 11:128726554-128726576 CCGCCTAAGCTCCATACCAATGG 0: 1
1: 0
2: 1
3: 5
4: 60
Right 1090640692 11:128726575-128726597 GGCCTCTGGCCAGAACAAAGTGG 0: 1
1: 0
2: 0
3: 15
4: 199
1090640685_1090640692 -1 Left 1090640685 11:128726553-128726575 CCCGCCTAAGCTCCATACCAATG 0: 1
1: 0
2: 1
3: 5
4: 99
Right 1090640692 11:128726575-128726597 GGCCTCTGGCCAGAACAAAGTGG 0: 1
1: 0
2: 0
3: 15
4: 199
1090640679_1090640692 7 Left 1090640679 11:128726545-128726567 CCCCCACCCCCGCCTAAGCTCCA 0: 1
1: 0
2: 2
3: 43
4: 507
Right 1090640692 11:128726575-128726597 GGCCTCTGGCCAGAACAAAGTGG 0: 1
1: 0
2: 0
3: 15
4: 199
1090640675_1090640692 14 Left 1090640675 11:128726538-128726560 CCCCCTACCCCCACCCCCGCCTA 0: 1
1: 0
2: 19
3: 238
4: 1938
Right 1090640692 11:128726575-128726597 GGCCTCTGGCCAGAACAAAGTGG 0: 1
1: 0
2: 0
3: 15
4: 199
1090640688_1090640692 -5 Left 1090640688 11:128726557-128726579 CCTAAGCTCCATACCAATGGCCT 0: 1
1: 0
2: 0
3: 9
4: 128
Right 1090640692 11:128726575-128726597 GGCCTCTGGCCAGAACAAAGTGG 0: 1
1: 0
2: 0
3: 15
4: 199
1090640668_1090640692 30 Left 1090640668 11:128726522-128726544 CCTGCCACCCTCCCACCCCCCTA 0: 1
1: 1
2: 43
3: 277
4: 2616
Right 1090640692 11:128726575-128726597 GGCCTCTGGCCAGAACAAAGTGG 0: 1
1: 0
2: 0
3: 15
4: 199
1090640670_1090640692 23 Left 1090640670 11:128726529-128726551 CCCTCCCACCCCCCTACCCCCAC 0: 1
1: 8
2: 163
3: 629
4: 3904
Right 1090640692 11:128726575-128726597 GGCCTCTGGCCAGAACAAAGTGG 0: 1
1: 0
2: 0
3: 15
4: 199
1090640673_1090640692 18 Left 1090640673 11:128726534-128726556 CCACCCCCCTACCCCCACCCCCG 0: 1
1: 14
2: 476
3: 9691
4: 16524
Right 1090640692 11:128726575-128726597 GGCCTCTGGCCAGAACAAAGTGG 0: 1
1: 0
2: 0
3: 15
4: 199
1090640680_1090640692 6 Left 1090640680 11:128726546-128726568 CCCCACCCCCGCCTAAGCTCCAT 0: 1
1: 0
2: 0
3: 19
4: 267
Right 1090640692 11:128726575-128726597 GGCCTCTGGCCAGAACAAAGTGG 0: 1
1: 0
2: 0
3: 15
4: 199
1090640677_1090640692 12 Left 1090640677 11:128726540-128726562 CCCTACCCCCACCCCCGCCTAAG 0: 1
1: 0
2: 2
3: 56
4: 689
Right 1090640692 11:128726575-128726597 GGCCTCTGGCCAGAACAAAGTGG 0: 1
1: 0
2: 0
3: 15
4: 199
1090640671_1090640692 22 Left 1090640671 11:128726530-128726552 CCTCCCACCCCCCTACCCCCACC 0: 3
1: 14
2: 272
3: 1251
4: 6331
Right 1090640692 11:128726575-128726597 GGCCTCTGGCCAGAACAAAGTGG 0: 1
1: 0
2: 0
3: 15
4: 199
1090640684_1090640692 0 Left 1090640684 11:128726552-128726574 CCCCGCCTAAGCTCCATACCAAT 0: 1
1: 0
2: 0
3: 6
4: 48
Right 1090640692 11:128726575-128726597 GGCCTCTGGCCAGAACAAAGTGG 0: 1
1: 0
2: 0
3: 15
4: 199
1090640682_1090640692 4 Left 1090640682 11:128726548-128726570 CCACCCCCGCCTAAGCTCCATAC 0: 1
1: 0
2: 0
3: 4
4: 96
Right 1090640692 11:128726575-128726597 GGCCTCTGGCCAGAACAAAGTGG 0: 1
1: 0
2: 0
3: 15
4: 199
1090640683_1090640692 1 Left 1090640683 11:128726551-128726573 CCCCCGCCTAAGCTCCATACCAA 0: 1
1: 0
2: 0
3: 6
4: 54
Right 1090640692 11:128726575-128726597 GGCCTCTGGCCAGAACAAAGTGG 0: 1
1: 0
2: 0
3: 15
4: 199
1090640674_1090640692 15 Left 1090640674 11:128726537-128726559 CCCCCCTACCCCCACCCCCGCCT 0: 1
1: 4
2: 62
3: 519
4: 3377
Right 1090640692 11:128726575-128726597 GGCCTCTGGCCAGAACAAAGTGG 0: 1
1: 0
2: 0
3: 15
4: 199
1090640672_1090640692 19 Left 1090640672 11:128726533-128726555 CCCACCCCCCTACCCCCACCCCC 0: 1
1: 21
2: 493
3: 9794
4: 16143
Right 1090640692 11:128726575-128726597 GGCCTCTGGCCAGAACAAAGTGG 0: 1
1: 0
2: 0
3: 15
4: 199
1090640676_1090640692 13 Left 1090640676 11:128726539-128726561 CCCCTACCCCCACCCCCGCCTAA 0: 1
1: 0
2: 8
3: 144
4: 1394
Right 1090640692 11:128726575-128726597 GGCCTCTGGCCAGAACAAAGTGG 0: 1
1: 0
2: 0
3: 15
4: 199
1090640669_1090640692 26 Left 1090640669 11:128726526-128726548 CCACCCTCCCACCCCCCTACCCC 0: 1
1: 5
2: 99
3: 968
4: 8754
Right 1090640692 11:128726575-128726597 GGCCTCTGGCCAGAACAAAGTGG 0: 1
1: 0
2: 0
3: 15
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090640692 Original CRISPR GGCCTCTGGCCAGAACAAAG TGG Intronic
900866522 1:5272778-5272800 GGCCTTTGACCACACCAAAGAGG + Intergenic
901034629 1:6328934-6328956 GGCCCCTGGCCAGGCCAAGGGGG - Intronic
901347826 1:8562735-8562757 GGACTCTGGGCAAAAAAAAGGGG + Intronic
901646572 1:10720039-10720061 GGCCTCTGGGCAGAGCAGTGGGG - Intronic
902839737 1:19067320-19067342 GCCCTCGTGCCAGAACAAACAGG - Intergenic
903312652 1:22471945-22471967 ATCCTCTGGCCAGAACCAGGGGG - Intronic
903684000 1:25117680-25117702 GGCCTCAGGCCAGAACCACTCGG + Intergenic
903826430 1:26148940-26148962 GGCCTCTGGCCATGACATGGAGG + Intergenic
905425620 1:37881716-37881738 TGCCTCAGACCAGAACACAGAGG + Intronic
906178386 1:43796282-43796304 GGCCTCTGGCCAGAAAGCTGGGG - Intronic
906528158 1:46508462-46508484 GGCCTCTGGGCAGAACTCAGTGG + Intronic
907457089 1:54582830-54582852 GGCAACTGGGCAGAACAAAAGGG - Intronic
910494500 1:87811440-87811462 AGACACTGGCAAGAACAAAGTGG - Intergenic
912865943 1:113256403-113256425 GGCCTCTGGGTAGAAGACAGAGG + Intergenic
914439368 1:147690453-147690475 AGCCTGTGGCCAGTACAAACTGG - Intergenic
915103277 1:153515832-153515854 GCCCTCTGTCCAGAAGAATGAGG - Intergenic
915901046 1:159846974-159846996 GGCATCTGGGCAGAAGAAGGGGG + Intronic
922742213 1:228020397-228020419 GGCCTCTGGACAGGAGAAGGTGG - Intronic
922898520 1:229118959-229118981 GGCCTCTGGTCAGAACCAGGAGG + Intergenic
923957007 1:239033301-239033323 GGCACCTGGCTAGAACAAAAAGG - Intergenic
1063024660 10:2165947-2165969 TGGCTCTGGCCCAAACAAAGAGG - Intergenic
1063860636 10:10303970-10303992 GGTCTCTTGCCAGAAAGAAGAGG + Intergenic
1066505585 10:36039119-36039141 GGCCTTTGGACAGAACCATGTGG + Intergenic
1067206174 10:44215791-44215813 AGACACTGGCCAAAACAAAGGGG - Intergenic
1067770597 10:49120830-49120852 GGTCTCTGGCCTGAGCACAGAGG - Intergenic
1069159861 10:65079997-65080019 GGAAACTGGCCAAAACAAAGGGG - Intergenic
1069931175 10:71882718-71882740 GGCCTCTGGGCAGGCCAAGGAGG + Intergenic
1071570171 10:86692385-86692407 GGCCTCTGCCCAGCACACAGTGG + Intronic
1072273478 10:93800181-93800203 GGCCTTTGGACAGGACACAGTGG - Intergenic
1074459033 10:113620400-113620422 GGGCCCTGGCAAAAACAAAGTGG - Intronic
1075898591 10:126019760-126019782 ATCCTCTGGCCAGAACAACTCGG - Exonic
1083202886 11:61131082-61131104 GCCCTCTGGCCAGAGGGAAGCGG - Exonic
1083433857 11:62629612-62629634 AGGCCCTGGCCAGGACAAAGGGG + Exonic
1083493165 11:63027934-63027956 GGGAACTGGCCAGAACAAAGGGG + Intergenic
1084640983 11:70425638-70425660 GGGCTCTTCCCAGAGCAAAGGGG + Intronic
1088533291 11:110833794-110833816 GTCCTCTTTCCACAACAAAGAGG + Intergenic
1089092724 11:115891722-115891744 GTCCTATGGCCAGCACCAAGAGG - Intergenic
1089521826 11:119069668-119069690 GGCCTCAGTTCAGTACAAAGTGG - Intronic
1090204816 11:124878346-124878368 GGCTTCTGGCCAGTTCAGAGAGG - Exonic
1090640692 11:128726575-128726597 GGCCTCTGGCCAGAACAAAGTGG + Intronic
1092762708 12:11823959-11823981 GGTCTCTGGCCCCACCAAAGGGG - Intronic
1095747858 12:45679700-45679722 GGTATCTGGGCAAAACAAAGAGG + Intergenic
1098163613 12:67671428-67671450 GCCCTCTGGCCAGCAGTAAGAGG + Intergenic
1099648003 12:85384417-85384439 GTTCTCTGCCCAGAACAATGAGG + Intergenic
1100268672 12:93002700-93002722 GGACTGTGTCCAGAACAAAGGGG + Intergenic
1100291058 12:93215238-93215260 GCCTCCTGGCCAGAACTAAGGGG - Intergenic
1100408329 12:94290560-94290582 GGCCTCTGGCCTAAACTTAGCGG + Intronic
1102471155 12:113160602-113160624 GGACCCAGGCCAGATCAAAGAGG + Intronic
1103725536 12:122995777-122995799 GGCCTCTTGCCAAACCAGAGGGG + Intronic
1103915720 12:124374636-124374658 GGCCGCTGGCCAGAGCCCAGAGG - Intronic
1105644486 13:22302821-22302843 AGACACTGGCCAAAACAAAGGGG + Intergenic
1105913785 13:24894392-24894414 GGCCTCTGGCCCAAGCACAGGGG + Intronic
1106009187 13:25801578-25801600 GGCCTCTGGCAAGAAGAAGAAGG - Intronic
1107966693 13:45603910-45603932 GGGCCCTGGCCAGCACACAGCGG + Intronic
1109508455 13:63337172-63337194 GCCTCCTGGCCAGAACACAGGGG - Intergenic
1111246425 13:85547717-85547739 AGCGACTGGCCAAAACAAAGGGG + Intergenic
1111931805 13:94520373-94520395 TGCCTTTGACCAGAAAAAAGAGG - Intergenic
1112882433 13:104123802-104123824 AGAAACTGGCCAGAACAAAGGGG - Intergenic
1113684552 13:112273358-112273380 GGCCTCTGCTCAGGACAGAGGGG - Intergenic
1115347312 14:32356686-32356708 GGAATATGGACAGAACAAAGAGG - Intronic
1119615618 14:76096874-76096896 GGACACTGGCCAGGCCAAAGGGG + Intergenic
1119657588 14:76428476-76428498 GGGCTCTGACCACCACAAAGGGG - Intronic
1120673274 14:87388687-87388709 AGCCCCTGGCAAGAACAAATGGG + Intergenic
1121662313 14:95644516-95644538 GCCCTCCAGACAGAACAAAGGGG + Intergenic
1121714140 14:96060700-96060722 GGCCTCTGGCCAAAGCATAGAGG - Intronic
1122405074 14:101495994-101496016 GGCCTCTGGCCAGATGAAGTGGG - Intergenic
1122416734 14:101553418-101553440 GGCCTCTGGCTTGCACAATGGGG - Intergenic
1127215900 15:56822863-56822885 GGGCTCTGGTTAAAACAAAGAGG - Intronic
1128548428 15:68582716-68582738 GGCCTCTGAGCAGTACAAAGCGG - Intronic
1130041220 15:80406293-80406315 GGCCTCTGTCCAGAACACTGAGG + Intronic
1130543656 15:84839732-84839754 GGCCTCTGCCCAGAACAGCAAGG + Exonic
1130569254 15:85025820-85025842 AGACTCGGGCCAGAACAATGTGG + Intronic
1131117327 15:89803355-89803377 GGCCTCTGCCCACCACAGAGGGG - Intronic
1134823037 16:17262011-17262033 GGCCTCTGGATAGAAAAAAAGGG - Intronic
1135229992 16:20697763-20697785 GGCTTCTGGCCACAGCGAAGGGG + Intronic
1136844446 16:33565094-33565116 GGCTTCTGGCCAGAACTCAAAGG - Intergenic
1137037399 16:35578295-35578317 GGCCTCAGACAAGAACAGAGGGG - Intergenic
1140954863 16:79853544-79853566 GGGTTCTGGCCAGTACAATGAGG - Intergenic
1141332277 16:83122182-83122204 GTCCTCTGATCAGATCAAAGAGG + Intronic
1141584514 16:85024680-85024702 GTGGTCTGGCCAGAACAAGGAGG - Intergenic
1141690506 16:85593853-85593875 TTCTTCTGGCCAGAACAATGCGG + Intergenic
1141885136 16:86886326-86886348 GGCCTCAGGCCAGCACCATGGGG + Intergenic
1142166898 16:88596040-88596062 TGCCCCTGGCCAGAGTAAAGGGG - Intronic
1142341077 16:89522966-89522988 GGCCTGGGGCCAGCACAGAGGGG - Intronic
1203154613 16_KI270728v1_random:1865393-1865415 GGCTTCTGGCCAGAACTCAAAGG - Intergenic
1142544575 17:690979-691001 GAGCTCGGCCCAGAACAAAGAGG + Intronic
1143282403 17:5764721-5764743 GTGCTGTGGCCAGAAGAAAGGGG - Intergenic
1144057031 17:11552394-11552416 AGCCTCTTGGCAGAAAAAAGAGG + Intronic
1144863788 17:18322300-18322322 TGCACCTGGCCTGAACAAAGAGG + Intronic
1149113588 17:53063727-53063749 GGACATTGGCCAAAACAAAGGGG - Intergenic
1149624385 17:58069748-58069770 TCCCTCTGGCCAGAACTTAGAGG - Intergenic
1150147249 17:62779267-62779289 GGCCTAGGGCCAGAAAGAAGAGG + Intronic
1150762375 17:67974358-67974380 GGCCTCTGGTCAGCAAGAAGTGG + Intronic
1150945731 17:69743519-69743541 GCCCTCTGGCCAGAACTTGGGGG - Intergenic
1153169032 18:2293823-2293845 GCCTTCTGGCCAGAACTCAGGGG - Intergenic
1157429934 18:47616334-47616356 GGCCTCTGGCAAGACCAGACAGG - Intergenic
1157535124 18:48452259-48452281 GGGGTGTGGCCAGAAGAAAGGGG - Intergenic
1160847138 19:1171603-1171625 GAGCTCTGCCCCGAACAAAGAGG - Intronic
1161031973 19:2061743-2061765 GGCCTCCGCCCAGAACACAGCGG - Intergenic
1162278166 19:9674857-9674879 GGCCTCTGGCCAGTTCCGAGAGG - Intronic
1165791296 19:38494273-38494295 GGCCTTGGACCAGAACAATGTGG - Intronic
1166688253 19:44808785-44808807 GGCCCCTGGTCAGAATAACGAGG + Intergenic
1166762929 19:45235811-45235833 AGCCTCTGGCCAGAACGTGGAGG + Intronic
1167393532 19:49211980-49212002 GGTCTCCGGCAAGAACAATGGGG - Intergenic
1167838065 19:52091133-52091155 TGCCTGTGGACTGAACAAAGGGG - Intronic
1168132178 19:54328579-54328601 GGTCTCTGCTCAGAACAAGGTGG - Intergenic
925738720 2:6986448-6986470 GGCCTCTGGCCAGCTCAACAAGG - Intronic
925858279 2:8151344-8151366 GGCCTCTGGCAATCACAAATCGG - Intergenic
927211782 2:20643296-20643318 GCCCTCTGCACAGAACCAAGTGG + Intronic
927296716 2:21463260-21463282 GACCTGTGGCCATAATAAAGTGG - Intergenic
930332370 2:50001847-50001869 GGCTTCTGGCCAGTATAAAATGG + Intronic
930518180 2:52433310-52433332 GGCCTCAGACAAGGACAAAGGGG + Intergenic
930606612 2:53499550-53499572 AGCGTCTGCCTAGAACAAAGTGG - Intergenic
931474608 2:62574643-62574665 GGAATCTGACCAGAACAAGGCGG + Intergenic
933195075 2:79380057-79380079 TCCCTCTGGACAGAAGAAAGTGG - Intronic
936753789 2:115678949-115678971 AGAAACTGGCCAGAACAAAGGGG - Intronic
938798696 2:134740181-134740203 GGCCACCGCTCAGAACAAAGGGG + Intergenic
939632924 2:144547151-144547173 GGCATCGGGCCAGAAAAAACAGG - Intergenic
941236811 2:162985415-162985437 TGCTGCTGGCCAGAACAAATGGG - Intergenic
941572582 2:167190273-167190295 GGCCTCTGAAAAGAACAGAGAGG - Intronic
942367008 2:175238763-175238785 AGCCATTGGCCAAAACAAAGGGG + Intergenic
943271448 2:185810723-185810745 AGCCTCTGTCCACAAAAAAGAGG - Intronic
947184917 2:227446233-227446255 GGCCTCAGGCCAGAGCCAGGTGG + Intergenic
947947733 2:234120871-234120893 GCCCTGTGGCCAGGACACAGGGG + Intergenic
1171097983 20:22350620-22350642 AGAGTCTGGCCAGAACACAGAGG + Intergenic
1173158970 20:40638519-40638541 GGCCACTGTCCAGCACAATGGGG - Intergenic
1173905861 20:46628292-46628314 AGCCTCTGGACAGAAACAAGTGG - Intronic
1173987620 20:47274574-47274596 GGACTCTGGTCAGAAACAAGGGG + Intronic
1177130513 21:17248923-17248945 AGACACTGGCCAAAACAAAGGGG - Intergenic
1177176402 21:17704746-17704768 GCCCCCTGGCCAGAACTCAGGGG + Intergenic
1177720815 21:24904378-24904400 GGCACCTGGGCAGAACACAGAGG + Intergenic
1178667258 21:34559303-34559325 AGCCACTGCCCAGAACAAACAGG - Intronic
1179291367 21:40020886-40020908 GGCCTCAGGGCAGAGCACAGTGG - Intronic
1179571592 21:42281830-42281852 GGTTTCTGCCCAGAACGAAGGGG - Intronic
1180049496 21:45324817-45324839 GGCCTCTGGCCAGCAGGATGTGG + Intergenic
1180172691 21:46067952-46067974 GCCCTGTGGCCAGTACAAGGGGG + Intergenic
1180296432 22:10941254-10941276 GTTCTCTGGCCAGGACACAGGGG - Intergenic
1181622925 22:24103212-24103234 TGCCTCTGGCCAGAACTGGGAGG - Intronic
1183978319 22:41525797-41525819 GGCCTCTGGCCACACCAAAAAGG - Intronic
1184189733 22:42886778-42886800 AGTCACTGGCCAGACCAAAGAGG + Intronic
950599262 3:14017440-14017462 GTCTCCTGGCCAGAACACAGGGG - Exonic
950828042 3:15846266-15846288 AGACACTGGCCAAAACAAAGAGG + Intronic
951756380 3:26095971-26095993 AGACACTGGCCAAAACAAAGAGG + Intergenic
953724016 3:45381890-45381912 GCCTTCTGGCCAGAACTCAGGGG - Intergenic
954462906 3:50637899-50637921 TTTTTCTGGCCAGAACAAAGTGG + Intronic
954517013 3:51187301-51187323 AGACTTTGGCCAAAACAAAGGGG - Intronic
955573466 3:60332333-60332355 AGCCTCTGGCCTGATCAAGGAGG + Intronic
956962972 3:74424131-74424153 GGCCACTTGCAGGAACAAAGAGG - Intronic
959851889 3:111097240-111097262 AGACACTGGCCAAAACAAAGGGG - Intronic
961960441 3:130848963-130848985 GGCTTCTGCCCACAATAAAGAGG + Intergenic
963008440 3:140748245-140748267 TGCCCCTGGGCAGAGCAAAGAGG - Intergenic
964710847 3:159669823-159669845 GGCTTGTGGGCAGAACACAGGGG - Intronic
965590792 3:170358191-170358213 AGCCCCGGGCCAGAACGAAGAGG - Intronic
966801769 3:183770615-183770637 TGCCTCTGGGAAGAACAAAGTGG - Intronic
967492115 3:190104566-190104588 GGCCTCTGGACAGTACATACAGG + Intronic
967775258 3:193379858-193379880 GCTCTCTGGCCAGGAGAAAGTGG + Intergenic
968107084 3:196009048-196009070 GGACTCTGGCAAGAACAATGGGG + Intergenic
969578605 4:8050854-8050876 GGCCTCTGGCCAACACAGGGAGG - Intronic
975079397 4:70257546-70257568 GACATCTGACCAGAACATAGAGG + Intergenic
975827641 4:78336678-78336700 GGCCTCTTGCCAGAATCCAGAGG + Intronic
979390040 4:120117521-120117543 AGACACTGGCCAAAACAAAGGGG + Intergenic
981134347 4:141192896-141192918 GCCTTCTAGCCAGAAAAAAGTGG - Intronic
981443274 4:144806939-144806961 GGCCTCTCTCCAGAACCCAGTGG - Intergenic
981461042 4:145014074-145014096 GGCTCCTGGCCAGAACTCAGGGG + Intronic
981923970 4:150117481-150117503 CCCCTTTGGCCAGAACCAAGGGG - Intronic
982935579 4:161471080-161471102 GGCTTCTAGCCAGAACAATTAGG - Intronic
983535034 4:168848256-168848278 GGCCCCAGGACAAAACAAAGTGG - Intronic
989640204 5:43576872-43576894 GGGCTCTGCCCAGAACTCAGTGG - Intergenic
994875244 5:105413637-105413659 GCCTCCTGGCCAGAACACAGAGG + Intergenic
995975799 5:118033884-118033906 GGCCGCTGGCCAGGGCAATGAGG + Intergenic
998807330 5:145931415-145931437 GACTGCTGGCCAGGACAAAGAGG - Intergenic
999126514 5:149250151-149250173 AGCCTGTGGCCAGGACACAGGGG + Intronic
999243370 5:150140199-150140221 AGCCTCTGGGAAGCACAAAGAGG - Intronic
1000744446 5:165015592-165015614 GGGCTATTGCCAAAACAAAGAGG - Intergenic
1001090511 5:168736782-168736804 GGCCACTGGGCAGAACACATAGG + Intronic
1002810442 6:623071-623093 GGCCCCTGGCCAGAAAGCAGTGG + Intronic
1002928458 6:1618529-1618551 GGCCTCTGGCTTGACCCAAGTGG + Intergenic
1010554146 6:77258273-77258295 GACCTCTGCCCAGAACTGAGGGG - Intergenic
1010707817 6:79135370-79135392 GTCTTCTGGCCAGAACTCAGGGG - Intergenic
1017581796 6:155873004-155873026 GCCCTGTGGTCAGAACAGAGAGG + Intergenic
1017688782 6:156942467-156942489 GGCCTCAGGCCAGCAGAAGGGGG + Intronic
1019163796 6:170086127-170086149 GGGCTCTTGACAGAACAGAGGGG - Intergenic
1020077273 7:5266715-5266737 GGTGTCTGTCCAGAACAGAGAGG - Intergenic
1021769417 7:23983899-23983921 CCCCTTTGGCCAGAACCAAGAGG + Intergenic
1023393379 7:39731417-39731439 GGCCTGTGTTCAGGACAAAGTGG + Intergenic
1028919013 7:96290087-96290109 GATCTCTGGCCAGAAGAGAGTGG + Intronic
1030808347 7:113945001-113945023 GCCCTTTGGCCAGAACCAAGGGG + Intronic
1031437407 7:121750018-121750040 AGCATCTTGACAGAACAAAGAGG + Intergenic
1031851686 7:126872383-126872405 GGCCTCTGGGTAAGACAAAGAGG - Intronic
1032269906 7:130394962-130394984 TGCTTCTGTACAGAACAAAGAGG + Exonic
1032688605 7:134259986-134260008 CCCATCTGGCCAGAGCAAAGTGG + Intronic
1035020671 7:155798205-155798227 GGCCTCTGGCCAGAACTCTGCGG - Intergenic
1036095164 8:5716039-5716061 GGCCTATGCCCAAAACACAGAGG + Intergenic
1037569658 8:20147720-20147742 TGCCTGTGGCCAGAGCAAACAGG + Exonic
1040620294 8:49084820-49084842 GGCATCTGCACACAACAAAGAGG + Intergenic
1042530708 8:69811875-69811897 CACCACTGGCCAGGACAAAGTGG + Intronic
1043241152 8:77937562-77937584 AGACACTGGCCAAAACAAAGGGG + Intergenic
1043354420 8:79395668-79395690 GGGCTCTGGAAAGAAAAAAGAGG - Intergenic
1049697132 8:143989932-143989954 GGCCTCTGGCCGGAGCGAAGAGG + Intronic
1053560624 9:39190248-39190270 GGCATCTCTCAAGAACAAAGGGG - Intronic
1053824725 9:42010492-42010514 GGCATCTCTCAAGAACAAAGGGG - Intronic
1054136495 9:61428707-61428729 GGCATCTCTCAAGAACAAAGGGG + Intergenic
1054605847 9:67176871-67176893 GGCATCTCTCAAGAACAAAGGGG + Intergenic
1055080727 9:72265721-72265743 AGACACTGGCCAAAACAAAGGGG + Intergenic
1057283514 9:93729301-93729323 GGCCTCTGGCTAGACCCTAGAGG - Intergenic
1057521482 9:95763971-95763993 GGCCTCTGCCCACTAGAAAGCGG - Intergenic
1060054222 9:120400012-120400034 GGCCTTTGGCAAGAACAGATAGG + Intronic
1060112934 9:120919483-120919505 AGCCCCTGCACAGAACAAAGAGG + Intronic
1186347165 X:8705573-8705595 AGCATCTGGCCTAAACAAAGTGG - Intronic
1187479582 X:19643026-19643048 GTCTTCTGGCCAGAAGGAAGAGG + Intronic
1188709624 X:33379312-33379334 GGACTCTGTCCCAAACAAAGGGG - Intergenic
1196934509 X:120716175-120716197 GGCATCTGGCCAGTAGAATGGGG + Intergenic
1198558817 X:137825918-137825940 GGCCTCTGACCAGAGGAAGGTGG + Intergenic
1200115302 X:153767379-153767401 GGCCTCTGGCCACAAGCAGGAGG - Exonic
1201374400 Y:13300926-13300948 GCACTCTGGCCTGAACAAAAGGG - Intronic