ID: 1090640695

View in Genome Browser
Species Human (GRCh38)
Location 11:128726592-128726614
Sequence AAGTGGATACTTGAGTCACT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1416
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 1396}

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090640686_1090640695 15 Left 1090640686 11:128726554-128726576 CCGCCTAAGCTCCATACCAATGG 0: 1
1: 0
2: 1
3: 5
4: 60
Right 1090640695 11:128726592-128726614 AAGTGGATACTTGAGTCACTTGG 0: 1
1: 0
2: 0
3: 19
4: 1396
1090640677_1090640695 29 Left 1090640677 11:128726540-128726562 CCCTACCCCCACCCCCGCCTAAG 0: 1
1: 0
2: 2
3: 56
4: 689
Right 1090640695 11:128726592-128726614 AAGTGGATACTTGAGTCACTTGG 0: 1
1: 0
2: 0
3: 19
4: 1396
1090640678_1090640695 28 Left 1090640678 11:128726541-128726563 CCTACCCCCACCCCCGCCTAAGC 0: 1
1: 0
2: 13
3: 139
4: 1451
Right 1090640695 11:128726592-128726614 AAGTGGATACTTGAGTCACTTGG 0: 1
1: 0
2: 0
3: 19
4: 1396
1090640683_1090640695 18 Left 1090640683 11:128726551-128726573 CCCCCGCCTAAGCTCCATACCAA 0: 1
1: 0
2: 0
3: 6
4: 54
Right 1090640695 11:128726592-128726614 AAGTGGATACTTGAGTCACTTGG 0: 1
1: 0
2: 0
3: 19
4: 1396
1090640680_1090640695 23 Left 1090640680 11:128726546-128726568 CCCCACCCCCGCCTAAGCTCCAT 0: 1
1: 0
2: 0
3: 19
4: 267
Right 1090640695 11:128726592-128726614 AAGTGGATACTTGAGTCACTTGG 0: 1
1: 0
2: 0
3: 19
4: 1396
1090640690_1090640695 4 Left 1090640690 11:128726565-128726587 CCATACCAATGGCCTCTGGCCAG 0: 1
1: 0
2: 1
3: 10
4: 165
Right 1090640695 11:128726592-128726614 AAGTGGATACTTGAGTCACTTGG 0: 1
1: 0
2: 0
3: 19
4: 1396
1090640679_1090640695 24 Left 1090640679 11:128726545-128726567 CCCCCACCCCCGCCTAAGCTCCA 0: 1
1: 0
2: 2
3: 43
4: 507
Right 1090640695 11:128726592-128726614 AAGTGGATACTTGAGTCACTTGG 0: 1
1: 0
2: 0
3: 19
4: 1396
1090640682_1090640695 21 Left 1090640682 11:128726548-128726570 CCACCCCCGCCTAAGCTCCATAC 0: 1
1: 0
2: 0
3: 4
4: 96
Right 1090640695 11:128726592-128726614 AAGTGGATACTTGAGTCACTTGG 0: 1
1: 0
2: 0
3: 19
4: 1396
1090640691_1090640695 -1 Left 1090640691 11:128726570-128726592 CCAATGGCCTCTGGCCAGAACAA 0: 1
1: 0
2: 2
3: 13
4: 196
Right 1090640695 11:128726592-128726614 AAGTGGATACTTGAGTCACTTGG 0: 1
1: 0
2: 0
3: 19
4: 1396
1090640681_1090640695 22 Left 1090640681 11:128726547-128726569 CCCACCCCCGCCTAAGCTCCATA 0: 1
1: 0
2: 0
3: 6
4: 113
Right 1090640695 11:128726592-128726614 AAGTGGATACTTGAGTCACTTGG 0: 1
1: 0
2: 0
3: 19
4: 1396
1090640693_1090640695 -8 Left 1090640693 11:128726577-128726599 CCTCTGGCCAGAACAAAGTGGAT 0: 1
1: 0
2: 1
3: 10
4: 143
Right 1090640695 11:128726592-128726614 AAGTGGATACTTGAGTCACTTGG 0: 1
1: 0
2: 0
3: 19
4: 1396
1090640685_1090640695 16 Left 1090640685 11:128726553-128726575 CCCGCCTAAGCTCCATACCAATG 0: 1
1: 0
2: 1
3: 5
4: 99
Right 1090640695 11:128726592-128726614 AAGTGGATACTTGAGTCACTTGG 0: 1
1: 0
2: 0
3: 19
4: 1396
1090640688_1090640695 12 Left 1090640688 11:128726557-128726579 CCTAAGCTCCATACCAATGGCCT 0: 1
1: 0
2: 0
3: 9
4: 128
Right 1090640695 11:128726592-128726614 AAGTGGATACTTGAGTCACTTGG 0: 1
1: 0
2: 0
3: 19
4: 1396
1090640676_1090640695 30 Left 1090640676 11:128726539-128726561 CCCCTACCCCCACCCCCGCCTAA 0: 1
1: 0
2: 8
3: 144
4: 1394
Right 1090640695 11:128726592-128726614 AAGTGGATACTTGAGTCACTTGG 0: 1
1: 0
2: 0
3: 19
4: 1396
1090640684_1090640695 17 Left 1090640684 11:128726552-128726574 CCCCGCCTAAGCTCCATACCAAT 0: 1
1: 0
2: 0
3: 6
4: 48
Right 1090640695 11:128726592-128726614 AAGTGGATACTTGAGTCACTTGG 0: 1
1: 0
2: 0
3: 19
4: 1396

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090640695 Original CRISPR AAGTGGATACTTGAGTCACT TGG Intronic
900264092 1:1748801-1748823 AAGTGCATCCTTGGCTCACTGGG + Intergenic
901089130 1:6629788-6629810 AAGATGACACTTGAGCCACTGGG + Intronic
902404497 1:16175352-16175374 AAGTGGACATTAGAGTCGCTCGG + Intergenic
904253753 1:29241513-29241535 AACTGGATACTTCAATGACTGGG - Intronic
906922541 1:50079694-50079716 AAGTTGTTACTTGAGTAACTGGG - Intronic
907946312 1:59139594-59139616 AAGTGGCAACCTGAGTCACAAGG + Intergenic
908270736 1:62419921-62419943 ATGTGAATACTTGAGGCAATAGG + Intergenic
908669651 1:66532884-66532906 AAGTGGGAAGTTGTGTCACTGGG - Intergenic
910092979 1:83487476-83487498 AAGTGCTTACTTGAGATACTGGG - Intergenic
910767664 1:90798574-90798596 AAGTTGATCCCTGAGTCTCTGGG + Intergenic
911470510 1:98312580-98312602 AAGGGGATACTTGTCTCAGTGGG + Intergenic
912588446 1:110788421-110788443 CAGTGGAAACTTGGGTCCCTGGG - Intergenic
915078799 1:153337156-153337178 AAGTGGATGCTTTGGTCAGTAGG - Intronic
916076987 1:161206752-161206774 CAGGGGATGCTTGAGTCATTAGG + Intronic
917407647 1:174724920-174724942 AAGTGCATGCTTGAGGCTCTTGG + Intronic
918036656 1:180879987-180880009 GAGTGGAAACTTGATACACTGGG + Intronic
919316113 1:195971951-195971973 CAGTGGAAACATGACTCACTGGG - Intergenic
1064629788 10:17297945-17297967 AAGTGGATACCTCTTTCACTTGG - Intergenic
1066816492 10:39423532-39423554 AAGTGGATATTTGGATCCCTTGG - Intergenic
1066817603 10:39440530-39440552 AAGTGGATATTTGGAGCACTTGG - Intergenic
1066819216 10:39464014-39464036 AAGTGGATATTTGAAGCACTTGG - Intergenic
1068507887 10:57926172-57926194 AAGTGGGTGTTTTAGTCACTTGG - Intergenic
1070662569 10:78317984-78318006 ACCTGGATTCCTGAGTCACTAGG - Intergenic
1072544631 10:96426983-96427005 ATGTGGATACTTAAGTCTGTGGG + Intronic
1076278143 10:129223546-129223568 AAGTGGATAAATGAGTGAGTGGG + Intergenic
1076524772 10:131105409-131105431 AAGTAGCTACATGAGTGACTGGG + Intronic
1080348308 11:31351901-31351923 AAGTGTAAAATTCAGTCACTTGG - Intronic
1082467190 11:53191027-53191049 AAGTGGATATTTGGACCACTTGG + Intergenic
1082554576 11:54547014-54547036 AAGTGGATATTTGGATCTCTTGG + Intergenic
1082953070 11:58838574-58838596 AAGTTAATACCTGAGTCATTAGG + Intronic
1084564931 11:69923316-69923338 AAATGCATGTTTGAGTCACTGGG + Intergenic
1087637190 11:100715352-100715374 CAGGGGATACTAGATTCACTGGG - Intronic
1090640695 11:128726592-128726614 AAGTGGATACTTGAGTCACTTGG + Intronic
1091181120 11:133605604-133605626 GAGTGGATGATTCAGTCACTGGG + Intergenic
1098037378 12:66318047-66318069 ATGTGGATACTTGGTTCAGTTGG + Intronic
1103588586 12:121974165-121974187 AAGGGGAAACCTGATTCACTTGG + Intronic
1105096418 13:16377984-16378006 AAGTGGATACTTGGATAGCTTGG + Intergenic
1105096584 13:16380713-16380735 AAGTGGATACTTGGATAGCTTGG + Intergenic
1105107663 13:16561662-16561684 AAGTGGATATTTGATTAGCTTGG + Intergenic
1105111422 13:16623054-16623076 AAGTGGATATTTGGATAACTTGG + Intergenic
1105115839 13:16695193-16695215 AAGTGGATATTTGGATAACTTGG + Intergenic
1105124923 13:16843589-16843611 AAGTGGATACTTGGATAGCTTGG + Intergenic
1105128266 13:16898151-16898173 AAGTGGATATTTGGATAACTTGG + Intergenic
1105153622 13:17312285-17312307 AAGTGGATATTTGGATAACTTGG + Intergenic
1105156292 13:17355943-17355965 AAGTGGATACTTGGATAGCTTGG + Intergenic
1105161769 13:17444929-17444951 AAGTGGATATTTGAATAGCTTGG + Intergenic
1105162073 13:17449845-17449867 AAGTGGATATTTGGGTAGCTTGG + Intergenic
1105185721 13:17819500-17819522 AAGTGGATATTTGCGTAGCTTGG + Intergenic
1105194201 13:17951071-17951093 AAGTGGATATTTGAATAGCTTGG + Intergenic
1105315670 13:19259731-19259753 AAGTGGATACCTGCAACACTGGG - Intergenic
1107758872 13:43654882-43654904 AAGTGGATACTTGCTTCATTGGG - Intronic
1109629750 13:65031561-65031583 AAGTGGGTTCTTGAGCCCCTAGG + Intergenic
1111160276 13:84384938-84384960 AAGTCAATATTTGAGTCTCTAGG - Intergenic
1116374312 14:44178551-44178573 AAGTGGAAACTTGGGTCAAATGG - Intergenic
1121156119 14:91686063-91686085 AAGCAGAAACTTGAGTAACTTGG - Intronic
1121804645 14:96806650-96806672 AACTGTATACATGAGTCATTTGG + Intronic
1124485393 15:30110307-30110329 AAGTGGACACCTGAGTCAGCAGG + Intergenic
1124518183 15:30386960-30386982 AAGTGGACACCTGAGTCAGCAGG - Exonic
1124540470 15:30579293-30579315 AAGTGGACACCTGAGTCAGCAGG + Intergenic
1124633567 15:31351001-31351023 AAGTGGTTCCTGGAGACACTGGG - Intronic
1124639618 15:31389391-31389413 ATGTGGATTCTTGACTCAATGGG + Intronic
1124758183 15:32428288-32428310 AAGTGGACACCTGAGTCAGCAGG - Intergenic
1127412632 15:58724543-58724565 AAGTGGAAACTTCAGGCTCTTGG - Intronic
1129819974 15:78593260-78593282 AAATGTATACTTCAGTCCCTTGG - Exonic
1130120874 15:81046526-81046548 CTGGGGATACGTGAGTCACTGGG + Intronic
1130904631 15:88231757-88231779 AGGTGGATACTAGAGTCACAAGG - Intronic
1132324875 15:100960581-100960603 AAGGGGATGCTTGAGGGACTTGG - Intronic
1133623326 16:7547343-7547365 AAGTGTATAATTGTGTCAGTTGG + Intronic
1134216910 16:12323118-12323140 ATGTGGTCACTGGAGTCACTGGG + Intronic
1135341647 16:21653531-21653553 AGGTAGATCCTAGAGTCACTGGG + Intronic
1135783849 16:25330121-25330143 AAATGGATACTAAAGTCACTTGG + Intergenic
1137096496 16:36314965-36314987 AAGTGGATACTTGGATGGCTTGG + Intergenic
1137096701 16:36317686-36317708 AAGTGGATACTTGGATGGCTTGG + Intergenic
1137096726 16:36318024-36318046 AAGTGGATACTTGGATGGCTTGG + Intergenic
1137096753 16:36318361-36318383 AAGTGGATACTTGGATGGCTTGG + Intergenic
1137096933 16:36320753-36320775 AAGTGGATACTTGGATGGCTTGG + Intergenic
1137097035 16:36322110-36322132 AAGTGGATACTTGGATGGCTTGG + Intergenic
1137535249 16:49316769-49316791 AAATGGATCCTTGAGTAACATGG - Intergenic
1138713933 16:59000058-59000080 AAGTGGAAACTGGAGTCAGGAGG + Intergenic
1144849284 17:18235880-18235902 AAGTTGAGACCTGAGTCACTGGG - Intronic
1148792030 17:50178548-50178570 AGGTGGCGACTTGAGTCACCAGG - Intergenic
1150902391 17:69295457-69295479 AAGGAGATAATTGAGTCACATGG + Intronic
1151898978 17:76999165-76999187 AAGAGGATAGGTGAGTCACATGG + Intergenic
1153986649 18:10356951-10356973 AACTGGTTACTTTAGACACTGGG - Intergenic
1154535418 18:15401446-15401468 AAGTGGATATTTGGAGCACTTGG + Intergenic
1156506121 18:37595277-37595299 AAGTGGATTCATGGGTCTCTTGG - Intergenic
1157138220 18:45079546-45079568 AAGTGGATACTTGCAAAACTTGG - Intergenic
1164342350 19:24417704-24417726 AAGTGGATATTTGAAGCGCTTGG + Intergenic
1164854000 19:31506596-31506618 AAGTAGATACTTCAGTCAAACGG - Intergenic
1166617523 19:44264020-44264042 AAGTGGATTCTGGGGTCACAAGG - Intronic
925089629 2:1143343-1143365 AAGTGGAAACATGAGTCCCTGGG + Intronic
926722742 2:15973628-15973650 ATGTGGAAACTTGAGTCTCAGGG - Intergenic
927718863 2:25370234-25370256 AAGTGGAGTGTTGAGTCAGTTGG - Intergenic
930027612 2:47038849-47038871 AAGAGGAAAGTTGAGTCACAAGG - Intronic
934332742 2:92086640-92086662 AAGTGGATATTTGGATCACATGG + Intergenic
935962587 2:108441988-108442010 TATTGGATACTTGGGTCATTTGG - Intergenic
937217698 2:120323241-120323263 AAGTGGATACATGAGTAACCAGG - Intergenic
938509280 2:131923682-131923704 AAGTGCATAAATGAGTCACAGGG + Intergenic
939209029 2:139147536-139147558 AAGAGGCTTCATGAGTCACTTGG + Intergenic
939979588 2:148763339-148763361 CAGTGGTTATTTTAGTCACTTGG + Intronic
941308400 2:163898445-163898467 AAGTGGACTCTTGAGTTCCTGGG - Intergenic
944346538 2:198672881-198672903 AGGTGGAGACTTTAGTGACTTGG - Intergenic
948221785 2:236275734-236275756 AAGGGGATGATTGAGTCACGAGG + Intergenic
1170323629 20:15130723-15130745 AAGTGTATACTAGAATCCCTGGG + Intronic
1170820189 20:19751105-19751127 AAGCGGCCACTTGAGTCTCTTGG + Intergenic
1171664229 20:27699572-27699594 AAGTGGATACTTGGCTAGCTTGG + Intergenic
1171683671 20:27991280-27991302 AAGTGGATATTTGGGTAGCTTGG + Intergenic
1173785020 20:45786660-45786682 AAATGGATAATTAGGTCACTGGG + Intronic
1177982251 21:27928719-27928741 AAGTGCATAAATGAGTCACAGGG - Intergenic
1178055864 21:28797636-28797658 AATTGGATTCTTCAGTCTCTAGG - Intergenic
1178447970 21:32662741-32662763 ATGTGGATACTGGTGTCATTTGG + Intronic
1180507869 22:16034892-16034914 AAGTGGATATTTGAAGCGCTTGG - Intergenic
1180966845 22:19793891-19793913 AAGAGGATACTTGGGTCTATAGG + Intronic
1181405199 22:22679534-22679556 AAGTGGATACCTGAGAGAATTGG + Intergenic
1183808606 22:40234997-40235019 AAGTGGATACTTTGAGCACTTGG + Intronic
1202727162 2_KI270716v1_random:13248-13270 AAGTGGATATTTGGATCACATGG + Intergenic
953313204 3:41900802-41900824 AAGTGGACACCTGAGTCAGCAGG - Exonic
955966431 3:64393700-64393722 CAGTTGATACATGAGTCACGTGG + Intronic
956342164 3:68237467-68237489 AAGTAGATAGTTGACTCAGTTGG + Intronic
957736426 3:84209927-84209949 ACGTGGGTACTTCTGTCACTTGG - Intergenic
958405814 3:93758157-93758179 AAGTGGATATTTGGATCACTTGG - Intergenic
958408100 3:93773636-93773658 AAGTGGATACTTGGGGAGCTTGG - Intergenic
959565221 3:107826423-107826445 AATTGGCTACTTGGGTCCCTGGG - Intergenic
960402902 3:117225424-117225446 AAGTGACTACTAGAATCACTGGG + Intergenic
971717906 4:30204571-30204593 AAGTGGCTAGTTGGGTAACTTGG - Intergenic
975736789 4:77389076-77389098 AAGTGGATTCTTGCATCACCTGG + Intronic
976120850 4:81779746-81779768 AAATGCATATTTGAGTCTCTTGG - Intronic
977082228 4:92545734-92545756 AAGTGGGTCTTTGATTCACTTGG + Intronic
982353564 4:154443045-154443067 GAGTGGATACTGGAGTGAGTAGG - Intronic
984026189 4:174546533-174546555 AAGTAGATAATTGAATCACGGGG + Intergenic
985334707 4:188879206-188879228 AAGTGGATTTCAGAGTCACTGGG - Intergenic
986069255 5:4265935-4265957 AAGAGGATGCTTGAGGCACCAGG + Intergenic
988351568 5:30115234-30115256 AAATGGAAACTTGAGTTTCTTGG + Intergenic
989858558 5:46333962-46333984 AAGTGGATACTTGGAGCGCTTGG - Intergenic
989859258 5:46345680-46345702 AAGTGGATATTTGGAGCACTTGG - Intergenic
989862569 5:46398186-46398208 AAGTGGATATTTGAACTACTTGG + Intergenic
989882407 5:46811237-46811259 AAGTGGATACTTGGAGCAATGGG + Intergenic
989882634 5:46815671-46815693 AAGTGGATACTTGGAGCAATGGG + Intergenic
989883119 5:46825214-46825236 AAGTGGATACTTGGAGCAATGGG + Intergenic
989883410 5:46830841-46830863 AAGTGGATACTTGGAGCAATGGG + Intergenic
989883712 5:46836812-46836834 AAGTGGATACTTGGAGCAATGGG + Intergenic
989883979 5:46842097-46842119 AAGTGGATACTTGGAGCAATGGG + Intergenic
989884782 5:46858117-46858139 AAGTGGATACTTGGAGCAATGGG + Intergenic
989885044 5:46863230-46863252 AAGTGGATACTTGGAGCAATGGG + Intergenic
989885256 5:46867319-46867341 AAGTGGATACTTGGAGCAATGGG + Intergenic
989885814 5:46878228-46878250 AAGTGGATACTTGGAGCAATGGG + Intergenic
989886091 5:46883684-46883706 AAGTGGATACTTGGAGCAATGGG + Intergenic
989886373 5:46889139-46889161 AAGTGGATACTTGGAGCAATGGG + Intergenic
989886597 5:46893570-46893592 AAGTGGATACTTGGAGCAATGGG + Intergenic
989886809 5:46897658-46897680 AAGTGGATACTTGGAGCAATGGG + Intergenic
989887057 5:46902432-46902454 AAGTGGATACTTGGAGCAATGGG + Intergenic
989887338 5:46907887-46907909 AAGTGGATACTTGGAGCAATGGG + Intergenic
989888483 5:46930560-46930582 AAGTGGATACTTGGAGCAATGGG + Intergenic
989888982 5:46940273-46940295 AAGTGGATACTTGGAGCAATGGG + Intergenic
989889261 5:46945728-46945750 AAGTGGATACTTGGAGCAATGGG + Intergenic
989889802 5:46956466-46956488 AAGTGGATACTTGGAGCAATGGG + Intergenic
989890496 5:46970276-46970298 AAGTGGATACTTGGAGCAATGGG + Intergenic
989890708 5:46974366-46974388 AAGTGGATACTTGGAGCAATGGG + Intergenic
989890983 5:46979823-46979845 AAGTGGATACTTGGAGCAATGGG + Intergenic
989891905 5:46997887-46997909 AAGTGGATACTTGGAGCAATGGG + Intergenic
989892181 5:47003343-47003365 AAGTGGATACTTGGAGCAATGGG + Intergenic
989892421 5:47007944-47007966 AAGTGGATACTTGGAGCAATGGG + Intergenic
989892705 5:47013399-47013421 AAGTGGATACTTGGAGCAATGGG + Intergenic
989893102 5:47021409-47021431 AAGTGGATACTTGGAGCAATGGG + Intergenic
989893382 5:47026866-47026888 AAGTGGATACTTGGAGCAATGGG + Intergenic
989893527 5:47029592-47029614 AAGTGGATACTTGGAGCAATGGG + Intergenic
989893813 5:47034799-47034821 AAGTGGATACTTGGAGCAATGGG + Intergenic
989894523 5:47048605-47048627 AAGTGGATACTTGGAGCAATGGG + Intergenic
989943234 5:50180569-50180591 AAGTGGATATTTGAGGTACTTGG - Intergenic
992086485 5:73282583-73282605 AAGTGGCTAATCGAGTCCCTTGG + Intergenic
992513537 5:77467029-77467051 AAGTGTATGCTTGACTGACTAGG - Intronic
992563170 5:77972646-77972668 GAGTGGAGACTTGGGTCCCTCGG - Intergenic
993513619 5:88801837-88801859 ATTAGGATACTTGAGACACTTGG - Intronic
996099767 5:119434340-119434362 AAGTGCATAATTAACTCACTTGG - Intergenic
999117663 5:149178002-149178024 GAATGGATGCTGGAGTCACTGGG - Intronic
1000593822 5:163190893-163190915 AAGATGATACTGCAGTCACTGGG + Intergenic
1002139246 5:177128809-177128831 AGGTGGATGCTTGAGTCCTTCGG + Intergenic
1005992455 6:30911876-30911898 AACTGAATACTTGGGTCTCTCGG + Intronic
1009611750 6:65952583-65952605 AAGAGGATCCTTGAGTCATTAGG - Intergenic
1012834825 6:104251974-104251996 AAGTGGGGACTTGGGTCCCTAGG - Intergenic
1013777035 6:113689869-113689891 AGGTGGATGTTTGAGTCACCAGG - Intergenic
1015961553 6:138655063-138655085 AAGTGGCTATTTGAAGCACTGGG + Intronic
1016394463 6:143608062-143608084 AAGTGGGTACTTGAATCCCCTGG - Intronic
1018746528 6:166766736-166766758 CTGTAGTTACTTGAGTCACTGGG - Intronic
1019143104 6:169960710-169960732 AGCTGGATCCCTGAGTCACTAGG + Intergenic
1020398319 7:7744103-7744125 AAGTAGATTCCTGAGTGACTAGG - Intronic
1021484803 7:21156195-21156217 AGGTGGATACTTTAGAAACTGGG - Intergenic
1025310928 7:57940540-57940562 AAGTGGATAATTGTTTCCCTTGG - Intergenic
1025311409 7:57946684-57946706 AAGTGGATATTTGTTTCCCTTGG - Intergenic
1025311637 7:57951470-57951492 AAGTGGATATTTGATTCCCTTGG - Intergenic
1025569356 7:62538872-62538894 AAGTGGATATTTGGAGCACTTGG + Intergenic
1025569391 7:62539556-62539578 AAGTGGATATTTGGAGCACTTGG + Intergenic
1025569560 7:62542801-62542823 AAGTGGATATTTGGAGCACTTGG + Intergenic
1025570505 7:62557225-62557247 AAGTGGATATTTGGATCACTTGG - Intergenic
1027129753 7:75582508-75582530 AAGTGGATACTTTAGGCTCTAGG + Intronic
1027309838 7:76943971-76943993 AAGTGCTTACTTGAGATACTGGG - Intergenic
1030859491 7:114606938-114606960 AAGTGGAGAGTTGAATGACTTGG + Intronic
1034849582 7:154481136-154481158 AAGGGGATGCTTGGGTGACTGGG + Intronic
1037731785 8:21531926-21531948 AAATGGAAACTGGAGTCCCTTGG - Intergenic
1040141917 8:43928986-43929008 AAGTGGATATTTGGATCACTTGG + Intergenic
1040273052 8:45979249-45979271 AAGTGGACACTTGAAGCACCTGG + Intergenic
1041977346 8:63815030-63815052 AAGTGGTTACTCGAGGCACCAGG + Intergenic
1042390733 8:68230715-68230737 AAGTGGATCCTTGACCCACTTGG + Intronic
1043378520 8:79677508-79677530 AAGTTGATTTTTCAGTCACTGGG + Intergenic
1046962306 8:120124671-120124693 TAGTGGATACCTGTTTCACTCGG + Intronic
1047776612 8:128076662-128076684 TAGTGGATACCTGGCTCACTGGG - Intergenic
1048335904 8:133502025-133502047 AAATGGATGCTTGAGTCCCCCGG - Intronic
1049369501 8:142257140-142257162 AAGTGGAGACTTGCCTCCCTCGG - Intronic
1050627936 9:7525855-7525877 ATAAGGATACATGAGTCACTTGG - Intergenic
1051800063 9:20922535-20922557 AATTGAAGACTTGAGTCAGTGGG - Intronic
1053716777 9:40904993-40905015 AAGTGGATATTTGGGGCCCTTGG + Intergenic
1056501908 9:87217904-87217926 GTGTGGATTCTTGAGGCACTAGG - Intergenic
1057079022 9:92158503-92158525 AAGTAGCTACATGAGTGACTGGG + Intergenic
1060060895 9:120458568-120458590 AAATGGATACTTAAGGCACACGG - Exonic
1203341655 Un_KI270424v1:1985-2007 AAGTGGATATTTGGATCTCTTGG + Intergenic
1203405060 Un_KI270529v1:1649-1671 AAGTGGATACTTGGATGGCTTGG - Intergenic
1186795033 X:13039003-13039025 ATGTAGATACTGCAGTCACTGGG - Intronic
1188383018 X:29520812-29520834 AAGTGTCTGCTTTAGTCACTAGG + Intronic
1189786470 X:44563269-44563291 ATGTGGATACTTGAGCCATTTGG - Intergenic
1191275377 X:58539622-58539644 AAGTGGATATTTGGACCACTGGG - Intergenic
1191276737 X:58608073-58608095 AAGTGGATATTTGGACCACTGGG + Intergenic
1191277041 X:58612188-58612210 AAGTGGATATTTGGACCACTGGG + Intergenic
1191277197 X:58614245-58614267 AAGTGGATATTTGGACCACTGGG + Intergenic
1191277509 X:58618362-58618384 AAGTGGATATTTGGACCACTGGG + Intergenic
1191277645 X:58620251-58620273 AAGTGGATATTTGGACCACTGGG + Intergenic
1191277948 X:58624365-58624387 AAGTGGATATTTGGACCACTGGG + Intergenic
1191278100 X:58626422-58626444 AAGTGGATATTTGGACCACTGGG + Intergenic
1191278255 X:58628479-58628501 AAGTGGATATTTGGACCACTGGG + Intergenic
1191278411 X:58630536-58630558 AAGTGGATATTTGGACCACTGGG + Intergenic
1191278726 X:58634650-58634672 AAGTGGATATTTGGACCACTGGG + Intergenic
1191279186 X:58640822-58640844 AAGTGGATATTTGGACCACTGGG + Intergenic
1191279338 X:58642882-58642904 AAGTGGATATTTGGACCACTGGG + Intergenic
1191279489 X:58644939-58644961 AAGTGGATATTTGGACCACTGGG + Intergenic
1191279640 X:58646997-58647019 AAGTGGATATTTGGACCACTGGG + Intergenic
1191279796 X:58649054-58649076 AAGTGGATATTTGGACCACTGGG + Intergenic
1191280102 X:58653169-58653191 AAGTGGATATTTGGACCACTGGG + Intergenic
1191280258 X:58655227-58655249 AAGTGGATATTTGGACCACTGGG + Intergenic
1191280691 X:58661228-58661250 AAGTGGATATTTGGACCACTGGG + Intergenic
1191280848 X:58663285-58663307 AAGTGGATATTTGGACCACTGGG + Intergenic
1191281003 X:58665343-58665365 AAGTGGATATTTGGACCACTGGG + Intergenic
1191281312 X:58669457-58669479 AAGTGGATATTTGGACCACTGGG + Intergenic
1191281462 X:58671515-58671537 AAGTGGATATTTGGACCACTGGG + Intergenic
1191281613 X:58673572-58673594 AAGTGGATATTTGGACCACTGGG + Intergenic
1191281920 X:58677692-58677714 AAGTGGATATTTGGACCACTGGG + Intergenic
1191282073 X:58679749-58679771 AAGTGGATATTTGGACCACTGGG + Intergenic
1191282229 X:58681806-58681828 AAGTGGATATTTGGACCACTGGG + Intergenic
1191282382 X:58683863-58683885 AAGTGGATATTTGGACCACTGGG + Intergenic
1191282537 X:58685920-58685942 AAGTGGATATTTGGACCACTGGG + Intergenic
1191282690 X:58687977-58687999 AAGTGGATATTTGGACCACTGGG + Intergenic
1191283148 X:58694149-58694171 AAGTGGATATTTGGACCACTGGG + Intergenic
1191283306 X:58696206-58696228 AAGTGGATATTTGGACCACTGGG + Intergenic
1191283460 X:58698264-58698286 AAGTGGATATTTGGACCACTGGG + Intergenic
1191283612 X:58700322-58700344 AAGTGGATATTTGGACCACTGGG + Intergenic
1191284227 X:58708548-58708570 AAGTGGATATTTGGACCACTGGG + Intergenic
1191284810 X:58716439-58716461 AAGTGGATATTTGGACCACTGGG + Intergenic
1191284970 X:58718496-58718518 AAGTGGATATTTGGACCACTGGG + Intergenic
1191285128 X:58720552-58720574 AAGTGGATATTTGGACCACTGGG + Intergenic
1191285281 X:58722609-58722631 AAGTGGATATTTGGACCACTGGG + Intergenic
1191285588 X:58726723-58726745 AAGTGGATATTTGGACCACTGGG + Intergenic
1191285742 X:58728780-58728802 AAGTGGATATTTGGACCACTGGG + Intergenic
1191285897 X:58730837-58730859 AAGTGGATATTTGGACCACTGGG + Intergenic
1191286207 X:58734949-58734971 AAGTGGATATTTGGACCACTGGG + Intergenic
1191286373 X:58737238-58737260 AAGTGGATATTTGGACCACTGGG + Intergenic
1191286528 X:58739295-58739317 AAGTGGATATTTGGACCACTGGG + Intergenic
1191286683 X:58741352-58741374 AAGTGGATATTTGGACCACTGGG + Intergenic
1191287423 X:58751296-58751318 AAGTGGATATTTGGACCACTGGG + Intergenic
1191287575 X:58753353-58753375 AAGTGGATATTTGGACCACTGGG + Intergenic
1191287880 X:58757466-58757488 AAGTGGATATTTGGACCACTGGG + Intergenic
1191288330 X:58763636-58763658 AAGTGGATATTTGGACCACTGGG + Intergenic
1191288485 X:58765693-58765715 AAGTGGATATTTGGACCACTGGG + Intergenic
1191288637 X:58767748-58767770 AAGTGGATATTTGGACCACTGGG + Intergenic
1191288789 X:58769805-58769827 AAGTGGATATTTGGACCACTGGG + Intergenic
1191289099 X:58773919-58773941 AAGTGGATATTTGGACCACTGGG + Intergenic
1191289410 X:58778033-58778055 AAGTGGATATTTGGACCACTGGG + Intergenic
1191289717 X:58782145-58782167 AAGTGGATATTTGGACCACTGGG + Intergenic
1191289872 X:58784202-58784224 AAGTGGATATTTGGACCACTGGG + Intergenic
1191290026 X:58786259-58786281 AAGTGGATATTTGGACCACTGGG + Intergenic
1191290180 X:58788319-58788341 AAGTGGATATTTGGACCACTGGG + Intergenic
1191290796 X:58796547-58796569 AAGTGGATATTTGGACCACTGGG + Intergenic
1191291105 X:58800662-58800684 AAGTGGATATTTGGACCACTGGG + Intergenic
1191291264 X:58802719-58802741 AAGTGGATATTTGGACCACTGGG + Intergenic
1191291784 X:58809330-58809352 AAGTGGATATTTGGACCACTGGG + Intergenic
1191291940 X:58811387-58811409 AAGTGGATATTTGGACCACTGGG + Intergenic
1191292091 X:58813444-58813466 AAGTGGATATTTGGACCACTGGG + Intergenic
1191292248 X:58815501-58815523 AAGTGGATATTTGGACCACTGGG + Intergenic
1191292407 X:58817558-58817580 AAGTGGATATTTGGACCACTGGG + Intergenic
1191292563 X:58819616-58819638 AAGTGGATATTTGGACCACTGGG + Intergenic
1191292719 X:58821675-58821697 AAGTGGATATTTGGACCACTGGG + Intergenic
1191292871 X:58823732-58823754 AAGTGGATATTTGGACCACTGGG + Intergenic
1191293490 X:58831961-58831983 AAGTGGATATTTGGACCACTGGG + Intergenic
1191293641 X:58834016-58834038 AAGTGGATATTTGGACCACTGGG + Intergenic
1191293946 X:58838130-58838152 AAGTGGATATTTGGACCACTGGG + Intergenic
1191294255 X:58842245-58842267 AAGTGGATATTTGGACCACTGGG + Intergenic
1191294558 X:58846361-58846383 AAGTGGATATTTGGACCACTGGG + Intergenic
1191295014 X:58852532-58852554 AAGTGGATATTTGGACCACTGGG + Intergenic
1191295464 X:58858702-58858724 AAGTGGATATTTGGACCACTGGG + Intergenic
1191295772 X:58862816-58862838 AAGTGGATATTTGGACCACTGGG + Intergenic
1191295927 X:58864873-58864895 AAGTGGATATTTGGACCACTGGG + Intergenic
1191296393 X:58871043-58871065 AAGTGGATATTTGGACCACTGGG + Intergenic
1191296553 X:58873101-58873123 AAGTGGATATTTGGACCACTGGG + Intergenic
1191296701 X:58875155-58875177 AAGTGGATATTTGGACCACTGGG + Intergenic
1191296859 X:58877213-58877235 AAGTGGATATTTGGACCACTGGG + Intergenic
1191297016 X:58879270-58879292 AAGTGGATATTTGGACCACTGGG + Intergenic
1191297301 X:58883043-58883065 AAGTGGATATTTGGACCACTGGG + Intergenic
1191297456 X:58885100-58885122 AAGTGGATATTTGGACCACTGGG + Intergenic
1191297611 X:58887156-58887178 AAGTGGATATTTGGACCACTGGG + Intergenic
1191297767 X:58889214-58889236 AAGTGGATATTTGGACCACTGGG + Intergenic
1191297923 X:58891270-58891292 AAGTGGATATTTGGACCACTGGG + Intergenic
1191298236 X:58895385-58895407 AAGTGGATATTTGGACCACTGGG + Intergenic
1191298698 X:58901556-58901578 AAGTGGATATTTGGACCACTGGG + Intergenic
1191298856 X:58903614-58903636 AAGTGGATATTTGGACCACTGGG + Intergenic
1191299791 X:58916295-58916317 AAGTGGATATTTGGACCACTGGG + Intergenic
1191299944 X:58918352-58918374 AAGTGGATATTTGGACCACTGGG + Intergenic
1191300100 X:58920409-58920431 AAGTGGATATTTGGACCACTGGG + Intergenic
1191300252 X:58922466-58922488 AAGTGGATATTTGGACCACTGGG + Intergenic
1191300408 X:58924523-58924545 AAGTGGATATTTGGACCACTGGG + Intergenic
1191300563 X:58926582-58926604 AAGTGGATATTTGGACCACTGGG + Intergenic
1191300876 X:58930696-58930718 AAGTGGATATTTGGACCACTGGG + Intergenic
1191301030 X:58932753-58932775 AAGTGGATATTTGGACCACTGGG + Intergenic
1191301181 X:58934810-58934832 AAGTGGATATTTGGACCACTGGG + Intergenic
1191301336 X:58936867-58936889 AAGTGGATATTTGGACCACTGGG + Intergenic
1191301495 X:58938924-58938946 AAGTGGATATTTGGACCACTGGG + Intergenic
1191301807 X:58943039-58943061 AAGTGGATATTTGGACCACTGGG + Intergenic
1191301961 X:58945095-58945117 AAGTGGATATTTGGACCACTGGG + Intergenic
1191302240 X:58948866-58948888 AAGTGGATATTTGGACCACTGGG + Intergenic
1191302543 X:58952980-58953002 AAGTGGATATTTGGACCACTGGG + Intergenic
1191303007 X:58959147-58959169 AAGTGGATATTTGGACCACTGGG + Intergenic
1191303317 X:58963262-58963284 AAGTGGATATTTGGACCACTGGG + Intergenic
1191303471 X:58965318-58965340 AAGTGGATATTTGGACCACTGGG + Intergenic
1191303603 X:58967034-58967056 AAGTGGATATTTGGACCACTGGG + Intergenic
1191303762 X:58969091-58969113 AAGTGGATATTTGGACCACTGGG + Intergenic
1191303916 X:58971148-58971170 AAGTGGATATTTGGACCACTGGG + Intergenic
1191304059 X:58973034-58973056 AAGTGGATATTTGGACCACTGGG + Intergenic
1191304211 X:58975089-58975111 AAGTGGATATTTGGACCACTGGG + Intergenic
1191304343 X:58976805-58976827 AAGTGGATATTTGGACCACTGGG + Intergenic
1191304649 X:58980919-58980941 AAGTGGATATTTGGACCACTGGG + Intergenic
1191304807 X:58982976-58982998 AAGTGGATATTTGGACCACTGGG + Intergenic
1191304963 X:58985033-58985055 AAGTGGATATTTGGACCACTGGG + Intergenic
1191305640 X:58993706-58993728 AAGTGGATATTTGGACCACTGGG + Intergenic
1191305794 X:58995767-58995789 AAGTGGATATTTGGACCACTGGG + Intergenic
1191306404 X:59003996-59004018 AAGTGGATATTTGGACCACTGGG + Intergenic
1191306706 X:59008110-59008132 AAGTGGATATTTGGACCACTGGG + Intergenic
1191307477 X:59018398-59018420 AAGTGGATATTTGGACCACTGGG + Intergenic
1191307790 X:59022512-59022534 AAGTGGATATTTGGACCACTGGG + Intergenic
1191307944 X:59024568-59024590 AAGTGGATATTTGGACCACTGGG + Intergenic
1191308407 X:59030736-59030758 AAGTGGATATTTGGACCACTGGG + Intergenic
1191308860 X:59036907-59036929 AAGTGGATATTTGGACCACTGGG + Intergenic
1191309172 X:59041027-59041049 AAGTGGATATTTGGACCACTGGG + Intergenic
1191309323 X:59043082-59043104 AAGTGGATATTTGGACCACTGGG + Intergenic
1191309635 X:59047197-59047219 AAGTGGATATTTGGACCACTGGG + Intergenic
1191310100 X:59053368-59053390 AAGTGGATATTTGGACCACTGGG + Intergenic
1191310386 X:59057141-59057163 AAGTGGATATTTGGACCACTGGG + Intergenic
1191310838 X:59063311-59063333 AAGTGGATATTTGGACCACTGGG + Intergenic
1191311465 X:59071717-59071739 AAGTGGATATTTGGACCACTGGG + Intergenic
1191311926 X:59077908-59077930 AAGTGGATATTTGGACCACTGGG + Intergenic
1191312083 X:59079965-59079987 AAGTGGATATTTGGACCACTGGG + Intergenic
1191312238 X:59082026-59082048 AAGTGGATATTTGGACCACTGGG + Intergenic
1191312391 X:59084084-59084106 AAGTGGATATTTGGACCACTGGG + Intergenic
1191312703 X:59088198-59088220 AAGTGGATATTTGGACCACTGGG + Intergenic
1191312855 X:59090255-59090277 AAGTGGATATTTGGACCACTGGG + Intergenic
1191313316 X:59096426-59096448 AAGTGGATATTTGGACCACTGGG + Intergenic
1191313469 X:59098483-59098505 AAGTGGATATTTGGACCACTGGG + Intergenic
1191313624 X:59100540-59100562 AAGTGGATATTTGGACCACTGGG + Intergenic
1191315129 X:59121108-59121130 AAGTGGATATTTGGACCACTGGG + Intergenic
1191315273 X:59122980-59123002 AAGTGGATATTTGGACCACTGGG + Intergenic
1191315425 X:59125033-59125055 AAGTGGATATTTGGACCACTGGG + Intergenic
1191315582 X:59127090-59127112 AAGTGGATATTTGGACCACTGGG + Intergenic
1191315738 X:59129147-59129169 AAGTGGATATTTGGACCACTGGG + Intergenic
1191315893 X:59131204-59131226 AAGTGGATATTTGGACCACTGGG + Intergenic
1191316202 X:59135323-59135345 AAGTGGATATTTGGACCACTGGG + Intergenic
1191316357 X:59137380-59137402 AAGTGGATATTTGGACCACTGGG + Intergenic
1191316514 X:59139436-59139458 AAGTGGATATTTGGACCACTGGG + Intergenic
1191316671 X:59141493-59141515 AAGTGGATATTTGGACCACTGGG + Intergenic
1191317112 X:59147321-59147343 AAGTGGATATTTGGACCACTGGG + Intergenic
1191317268 X:59149378-59149400 AAGTGGATATTTGGACCACTGGG + Intergenic
1191317426 X:59151435-59151457 AAGTGGATATTTGGACCACTGGG + Intergenic
1191317580 X:59153492-59153514 AAGTGGATATTTGGACCACTGGG + Intergenic
1191317737 X:59155551-59155573 AAGTGGATATTTGGACCACTGGG + Intergenic
1191317892 X:59157610-59157632 AAGTGGATATTTGGACCACTGGG + Intergenic
1191318048 X:59159667-59159689 AAGTGGATATTTGGACCACTGGG + Intergenic
1191318199 X:59161725-59161747 AAGTGGATATTTGGACCACTGGG + Intergenic
1191318355 X:59163782-59163804 AAGTGGATATTTGGACCACTGGG + Intergenic
1191318511 X:59165839-59165861 AAGTGGATATTTGGACCACTGGG + Intergenic
1191318667 X:59167896-59167918 AAGTGGATATTTGGACCACTGGG + Intergenic
1191318820 X:59169953-59169975 AAGTGGATATTTGGACCACTGGG + Intergenic
1191318978 X:59172011-59172033 AAGTGGATATTTGGACCACTGGG + Intergenic
1191319127 X:59174067-59174089 AAGTGGATATTTGGACCACTGGG + Intergenic
1191319581 X:59180237-59180259 AAGTGGATATTTGGACCACTGGG + Intergenic
1191319738 X:59182294-59182316 AAGTGGATATTTGGACCACTGGG + Intergenic
1191319892 X:59184352-59184374 AAGTGGATATTTGGACCACTGGG + Intergenic
1191320349 X:59190524-59190546 AAGTGGATATTTGGACCACTGGG + Intergenic
1191320504 X:59192581-59192603 AAGTGGATATTTGGACCACTGGG + Intergenic
1191320660 X:59194637-59194659 AAGTGGATATTTGGACCACTGGG + Intergenic
1191320815 X:59196691-59196713 AAGTGGATATTTGGACCACTGGG + Intergenic
1191320971 X:59198748-59198770 AAGTGGATATTTGGACCACTGGG + Intergenic
1191321125 X:59200805-59200827 AAGTGGATATTTGGACCACTGGG + Intergenic
1191321436 X:59204919-59204941 AAGTGGATATTTGGACCACTGGG + Intergenic
1191321744 X:59209033-59209055 AAGTGGATATTTGGACCACTGGG + Intergenic
1191321898 X:59211090-59211112 AAGTGGATATTTGGACCACTGGG + Intergenic
1191322050 X:59213147-59213169 AAGTGGATATTTGGACCACTGGG + Intergenic
1191322204 X:59215203-59215225 AAGTGGATATTTGGACCACTGGG + Intergenic
1191322358 X:59217261-59217283 AAGTGGATATTTGGACCACTGGG + Intergenic
1191322513 X:59219318-59219340 AAGTGGATATTTGGACCACTGGG + Intergenic
1191322671 X:59221375-59221397 AAGTGGATATTTGGACCACTGGG + Intergenic
1191322825 X:59223432-59223454 AAGTGGATATTTGGACCACTGGG + Intergenic
1191323725 X:59235774-59235796 AAGTGGATATTTGGACCACTGGG + Intergenic
1191323879 X:59237831-59237853 AAGTGGATATTTGGACCACTGGG + Intergenic
1191324034 X:59239888-59239910 AAGTGGATATTTGGACCACTGGG + Intergenic
1191324186 X:59241944-59241966 AAGTGGATATTTGGACCACTGGG + Intergenic
1191324344 X:59244001-59244023 AAGTGGATATTTGGACCACTGGG + Intergenic
1191324793 X:59250171-59250193 AAGTGGATATTTGGACCACTGGG + Intergenic
1191325106 X:59254285-59254307 AAGTGGATATTTGGACCACTGGG + Intergenic
1191325714 X:59262510-59262532 AAGTGGATATTTGGACCACTGGG + Intergenic
1191326016 X:59266621-59266643 AAGTGGATATTTGGACCACTGGG + Intergenic
1191326328 X:59270735-59270757 AAGTGGATATTTGGACCACTGGG + Intergenic
1191326482 X:59272793-59272815 AAGTGGATATTTGGACCACTGGG + Intergenic
1191326635 X:59274850-59274872 AAGTGGATATTTGGACCACTGGG + Intergenic
1191326788 X:59276904-59276926 AAGTGGATATTTGGACCACTGGG + Intergenic
1191326944 X:59278961-59278983 AAGTGGATATTTGGACCACTGGG + Intergenic
1191327253 X:59283074-59283096 AAGTGGATATTTGGACCACTGGG + Intergenic
1191327558 X:59287193-59287215 AAGTGGATATTTGGACCACTGGG + Intergenic
1191328022 X:59293361-59293383 AAGTGGATATTTGGACCACTGGG + Intergenic
1191328176 X:59295419-59295441 AAGTGGATATTTGGACCACTGGG + Intergenic
1191328487 X:59299533-59299555 AAGTGGATATTTGGACCACTGGG + Intergenic
1191328640 X:59301590-59301612 AAGTGGATATTTGGACCACTGGG + Intergenic
1191329248 X:59309816-59309838 AAGTGGATATTTGGACCACTGGG + Intergenic
1191329404 X:59311873-59311895 AAGTGGATATTTGGACCACTGGG + Intergenic
1191329860 X:59318044-59318066 AAGTGGATATTTGGACCACTGGG + Intergenic
1191330016 X:59320099-59320121 AAGTGGATATTTGGACCACTGGG + Intergenic
1191330322 X:59324212-59324234 AAGTGGATATTTGGACCACTGGG + Intergenic
1191330781 X:59330383-59330405 AAGTGGATATTTGGACCACTGGG + Intergenic
1191330932 X:59332441-59332463 AAGTGGATATTTGGACCACTGGG + Intergenic
1191331089 X:59334498-59334520 AAGTGGATATTTGGACCACTGGG + Intergenic
1191331244 X:59336555-59336577 AAGTGGATATTTGGACCACTGGG + Intergenic
1191331684 X:59342562-59342584 AAGTGGATATTTGGACCACTGGG + Intergenic
1191331841 X:59344619-59344641 AAGTGGATATTTGGACCACTGGG + Intergenic
1191331982 X:59346508-59346530 AAGTGGATATTTGGACCACTGGG + Intergenic
1191332573 X:59354566-59354588 AAGTGGATATTTGGACCACTGGG + Intergenic
1191332728 X:59356623-59356645 AAGTGGATATTTGGACCACTGGG + Intergenic
1191333034 X:59360737-59360759 AAGTGGATATTTGGACCACTGGG + Intergenic
1191333187 X:59362796-59362818 AAGTGGATATTTGGACCACTGGG + Intergenic
1191333500 X:59366910-59366932 AAGTGGATATTTGGACCACTGGG + Intergenic
1191333653 X:59368968-59368990 AAGTGGATATTTGGACCACTGGG + Intergenic
1191334112 X:59375138-59375160 AAGTGGATATTTGGACCACTGGG + Intergenic
1191334266 X:59377194-59377216 AAGTGGATATTTGGACCACTGGG + Intergenic
1191334421 X:59379252-59379274 AAGTGGATATTTGGACCACTGGG + Intergenic
1191334741 X:59383370-59383392 AAGTGGATATTTGGACCACTGGG + Intergenic
1191334894 X:59385426-59385448 AAGTGGATATTTGGACCACTGGG + Intergenic
1191335348 X:59391597-59391619 AAGTGGATATTTGGACCACTGGG + Intergenic
1191335503 X:59393654-59393676 AAGTGGATATTTGGACCACTGGG + Intergenic
1191335657 X:59395712-59395734 AAGTGGATATTTGGACCACTGGG + Intergenic
1191335968 X:59399827-59399849 AAGTGGATATTTGGACCACTGGG + Intergenic
1191336124 X:59401884-59401906 AAGTGGATATTTGGAACACTGGG + Intergenic
1191336586 X:59408053-59408075 AAGTGGATATTTGGACCACTGGG + Intergenic
1191337044 X:59414221-59414243 AAGTGGATATTTGGACCACTGGG + Intergenic
1191337199 X:59416278-59416300 AAGTGGATATTTGGACCACTGGG + Intergenic
1191337353 X:59418335-59418357 AAGTGGATATTTGGACCACTGGG + Intergenic
1191337661 X:59422453-59422475 AAGTGGATATTTGGACCACTGGG + Intergenic
1191337816 X:59424510-59424532 AAGTGGATATTTGGACCACTGGG + Intergenic
1191338440 X:59432739-59432761 AAGTGGATATTTGGACCACTGGG + Intergenic
1191338595 X:59434797-59434819 AAGTGGATATTTGGACCACTGGG + Intergenic
1191338902 X:59438910-59438932 AAGTGGATATTTGGACCACTGGG + Intergenic
1191339055 X:59440967-59440989 AAGTGGATATTTGGACCACTGGG + Intergenic
1191339213 X:59443024-59443046 AAGTGGATATTTGGACCACTGGG + Intergenic
1191339525 X:59447141-59447163 AAGTGGATATTTGGACCACTGGG + Intergenic
1191339679 X:59449195-59449217 AAGTGGATATTTGGACCACTGGG + Intergenic
1191339834 X:59451252-59451274 AAGTGGATATTTGGACCACTGGG + Intergenic
1191340136 X:59455366-59455388 AAGTGGATATTTGGACCACTGGG + Intergenic
1191340293 X:59457423-59457445 AAGTGGATATTTGGACCACTGGG + Intergenic
1191341054 X:59467710-59467732 AAGTGGATATTTGGACCACTGGG + Intergenic
1191341361 X:59471824-59471846 AAGTGGATATTTGGACCACTGGG + Intergenic
1191341515 X:59473881-59473903 AAGTGGATATTTGGACCACTGGG + Intergenic
1191341668 X:59475938-59475960 AAGTGGATATTTGGACCACTGGG + Intergenic
1191342042 X:59480497-59480519 AAGTGGATATTTGGACCACTGGG + Intergenic
1191342190 X:59482554-59482576 AAGTGGATATTTGGACCACTGGG + Intergenic
1191342347 X:59484611-59484633 AAGTGGATATTTGGACCACTGGG + Intergenic
1191342658 X:59488835-59488857 AAGTGGATATTTGGACCACTGGG + Intergenic
1191342792 X:59490728-59490750 AAGTGGATATTTGGAACACTGGG + Intergenic
1191342946 X:59492785-59492807 AAGTGGATATTTGGACCACTGGG + Intergenic
1191343102 X:59494842-59494864 AAGTGGATATTTGGACCACTGGG + Intergenic
1191343258 X:59496899-59496921 AAGTGGATATTTGGACCACTGGG + Intergenic
1191343565 X:59501012-59501034 AAGTGGATATTTGGACCACTGGG + Intergenic
1191343717 X:59503072-59503094 AAGTGGATATTTGGACCACTGGG + Intergenic
1191343870 X:59505129-59505151 AAGTGGATATTTGGACCACTGGG + Intergenic
1191344023 X:59507186-59507208 AAGTGGATATTTGGACCACTGGG + Intergenic
1191344177 X:59509243-59509265 AAGTGGATATTTGGACCACTGGG + Intergenic
1191344791 X:59517470-59517492 AAGTGGATATTTGGACCACTGGG + Intergenic
1191344946 X:59519527-59519549 AAGTGGATATTTGGACCACTGGG + Intergenic
1191345556 X:59527754-59527776 AAGTGGATATTTGGACCACTGGG + Intergenic
1191345864 X:59531870-59531892 AAGTGGATATTTGGACCACTGGG + Intergenic
1191346024 X:59533925-59533947 AAGTGGATATTTGGACCACTGGG + Intergenic
1191346335 X:59538038-59538060 AAGTGGATATTTGGACCACTGGG + Intergenic
1191346488 X:59540095-59540117 AAGTGGATATTTGGACCACTGGG + Intergenic
1191346793 X:59544209-59544231 AAGTGGATATTTGGACCACTGGG + Intergenic
1191346950 X:59546266-59546288 AAGTGGATATTTGGACCACTGGG + Intergenic
1191347258 X:59550384-59550406 AAGTGGATATTTGGACCACTGGG + Intergenic
1191347413 X:59552441-59552463 AAGTGGATATTTGGACCACTGGG + Intergenic
1191347568 X:59554497-59554519 AAGTGGATATTTGGACCACTGGG + Intergenic
1191348179 X:59562727-59562749 AAGTGGATATTTGGACCACTGGG + Intergenic
1191348335 X:59564783-59564805 AAGTGGATATTTGGACCACTGGG + Intergenic
1191348796 X:59570950-59570972 AAGTGGATATTTGGACCACTGGG + Intergenic
1191348947 X:59573007-59573029 AAGTGGATATTTGGACCACTGGG + Intergenic
1191349100 X:59575063-59575085 AAGTGGATATTTGGACCACTGGG + Intergenic
1191349253 X:59577120-59577142 AAGTGGATATTTGGACCACTGGG + Intergenic
1191349409 X:59579177-59579199 AAGTGGATATTTGGACCACTGGG + Intergenic
1191349564 X:59581231-59581253 AAGTGGATATTTGGACCACTGGG + Intergenic
1191349722 X:59583288-59583310 AAGTGGATATTTGGACCACTGGG + Intergenic
1191349869 X:59585344-59585366 AAGTGGATATTTGGACCACTGGG + Intergenic
1191350331 X:59591513-59591535 AAGTGGATATTTGGACCACTGGG + Intergenic
1191350760 X:59597327-59597349 AAGTGGATATTTGAACCACTGGG + Intergenic
1191351220 X:59603498-59603520 AAGTGGATATTTGGACCACTGGG + Intergenic
1191351370 X:59605555-59605577 AAGTGGATATTTGGACCACTGGG + Intergenic
1191351679 X:59609669-59609691 AAGTGGATATTTGGACCACTGGG + Intergenic
1191351835 X:59611727-59611749 AAGTGGATATTTGGACCACTGGG + Intergenic
1191352146 X:59615841-59615863 AAGTGGATATTTGGACCACTGGG + Intergenic
1191352429 X:59619616-59619638 AAGTGGATATTTGGACCACTGGG + Intergenic
1191352894 X:59625788-59625810 AAGTGGATATTTGGACCACTGGG + Intergenic
1191353201 X:59629902-59629924 AAGTGGATATTTGGACCACTGGG + Intergenic
1191353354 X:59631959-59631981 AAGTGGATATTTGGACCACTGGG + Intergenic
1191353504 X:59634016-59634038 AAGTGGATATTTGGACCACTGGG + Intergenic
1191353813 X:59638130-59638152 AAGTGGATATTTGGACCACTGGG + Intergenic
1191354275 X:59644300-59644322 AAGTGGATATTTGGACCACTGGG + Intergenic
1191354429 X:59646357-59646379 AAGTGGATATTTGGACCACTGGG + Intergenic
1191354581 X:59648414-59648436 AAGTGGATATTTGGACCACTGGG + Intergenic
1191354736 X:59650471-59650493 AAGTGGATATTTGGACCACTGGG + Intergenic
1191355196 X:59656645-59656667 AAGTGGATATTTGGACCACTGGG + Intergenic
1191355503 X:59660761-59660783 AAGTGGATATTTGGACCACTGGG + Intergenic
1191355659 X:59662818-59662840 AAGTGGATATTTGGACCACTGGG + Intergenic
1191355813 X:59664876-59664898 AAGTGGATATTTGGACCACTGGG + Intergenic
1191356121 X:59668995-59669017 AAGTGGATATTTGGACCACTGGG + Intergenic
1191356275 X:59671052-59671074 AAGTGGATATTTGGACCACTGGG + Intergenic
1191356425 X:59673109-59673131 AAGTGGATATTTGGACCACTGGG + Intergenic
1191356585 X:59675165-59675187 AAGTGGATATTTGGACCACTGGG + Intergenic
1191356738 X:59677222-59677244 AAGTGGATATTTGGACCACTGGG + Intergenic
1191356894 X:59679279-59679301 AAGTGGATATTTGGACCACTGGG + Intergenic
1191357050 X:59681336-59681358 AAGTGGATATTTGGACCACTGGG + Intergenic
1191357204 X:59683393-59683415 AAGTGGATATTTGGACCACTGGG + Intergenic
1191357357 X:59685450-59685472 AAGTGGATATTTGGACCACTGGG + Intergenic
1191357669 X:59689563-59689585 AAGTGGATATTTGGACCACTGGG + Intergenic
1191357824 X:59691620-59691642 AAGTGGATATTTGGACCACTGGG + Intergenic
1191357978 X:59693677-59693699 AAGTGGATATTTGGACCACTGGG + Intergenic
1191358133 X:59695734-59695756 AAGTGGATATTTGGACCACTGGG + Intergenic
1191358404 X:59699336-59699358 AAGTGGATATTTGGACCACTGGG + Intergenic
1191358562 X:59701393-59701415 AAGTGGATATTTGGACCACTGGG + Intergenic
1191358717 X:59703450-59703472 AAGTGGATATTTGGACCACTGGG + Intergenic
1191358871 X:59705507-59705529 AAGTGGATATTTGGACCACTGGG + Intergenic
1191359487 X:59713740-59713762 AAGTGGATATTTGGACCACTGGG + Intergenic
1191359641 X:59715797-59715819 AAGTGGATATTTGGACCACTGGG + Intergenic
1191359795 X:59717854-59717876 AAGTGGATATTTGGACCACTGGG + Intergenic
1191360101 X:59721968-59721990 AAGTGGATATTTGGACCACTGGG + Intergenic
1191360408 X:59726082-59726104 AAGTGGATATTTGGACCACTGGG + Intergenic
1191360563 X:59728141-59728163 AAGTGGATATTTGGACCACTGGG + Intergenic
1191361023 X:59734313-59734335 AAGTGGATATTTGGACCACTGGG + Intergenic
1191361179 X:59736370-59736392 AAGTGGATATTTGGACCACTGGG + Intergenic
1191361332 X:59738427-59738449 AAGTGGATATTTGGACCACTGGG + Intergenic
1191361634 X:59742541-59742563 AAGTGGATATTTGGACCACTGGG + Intergenic
1191361787 X:59744599-59744621 AAGTGGATATTTGGACCACTGGG + Intergenic
1191361939 X:59746657-59746679 AAGTGGATATTTGGACCACTGGG + Intergenic
1191362092 X:59748714-59748736 AAGTGGATATTTGGACCACTGGG + Intergenic
1191362247 X:59750771-59750793 AAGTGGATATTTGGACCACTGGG + Intergenic
1191362553 X:59754887-59754909 AAGTGGATATTTGGACCACTGGG + Intergenic
1191362706 X:59756945-59756967 AAGTGGATATTTGGACCACTGGG + Intergenic
1191362860 X:59759002-59759024 AAGTGGATATTTGGACCACTGGG + Intergenic
1191363016 X:59761059-59761081 AAGTGGATATTTGGACCACTGGG + Intergenic
1191363158 X:59762945-59762967 AAGTGGATATTTGGACCACTGGG + Intergenic
1191363313 X:59765002-59765024 AAGTGGATATTTGGACCACTGGG + Intergenic
1191363467 X:59767056-59767078 AAGTGGATATTTGGACCACTGGG + Intergenic
1191363623 X:59769113-59769135 AAGTGGATATTTGGACCACTGGG + Intergenic
1191363911 X:59772886-59772908 AAGTGGATATTTGGACCACTGGG + Intergenic
1191364064 X:59774943-59774965 AAGTGGATATTTGGACCACTGGG + Intergenic
1191364220 X:59777000-59777022 AAGTGGATATTTGGACCACTGGG + Intergenic
1191365149 X:59789345-59789367 AAGTGGATATTTGGACCACTGGG + Intergenic
1191365304 X:59791402-59791424 AAGTGGATATTTGGACCACTGGG + Intergenic
1191365747 X:59797403-59797425 AAGTGGATATTTGGACCACTGGG + Intergenic
1191365903 X:59799459-59799481 AAGTGGATATTTGGACCACTGGG + Intergenic
1191366056 X:59801513-59801535 AAGTGGATATTTGGACCACTGGG + Intergenic
1191366671 X:59809741-59809763 AAGTGGATATTTGGACCACTGGG + Intergenic
1191367134 X:59815911-59815933 AAGTGGATATTTGGACCACTGGG + Intergenic
1191367798 X:59824824-59824846 AAGTGGATATTTGGACCACTGGG + Intergenic
1191368103 X:59828940-59828962 AAGTGGATATTTGGACCACTGGG + Intergenic
1191368256 X:59831001-59831023 AAGTGGATATTTGGACCACTGGG + Intergenic
1191368408 X:59833057-59833079 AAGTGGATATTTGGACCACTGGG + Intergenic
1191368711 X:59837170-59837192 AAGTGGATATTTGGACCACTGGG + Intergenic
1191368868 X:59839227-59839249 AAGTGGATATTTGGACCACTGGG + Intergenic
1191369022 X:59841285-59841307 AAGTGGATATTTGGACCACTGGG + Intergenic
1191369177 X:59843341-59843363 AAGTGGATATTTGGACCACTGGG + Intergenic
1191369332 X:59845398-59845420 AAGTGGATATTTGGACCACTGGG + Intergenic
1191369630 X:59849511-59849533 AAGTGGATATTTGGACCACTGGG + Intergenic
1191369937 X:59853625-59853647 AAGTGGATATTTGGACCACTGGG + Intergenic
1191370090 X:59855681-59855703 AAGTGGATATTTGGACCACTGGG + Intergenic
1191370247 X:59857738-59857760 AAGTGGATATTTGGACCACTGGG + Intergenic
1191370555 X:59861852-59861874 AAGTGGATATTTGGACCACTGGG + Intergenic
1191370859 X:59865964-59865986 AAGTGGATATTTGGACCACTGGG + Intergenic
1191371015 X:59868021-59868043 AAGTGGATATTTGGACCACTGGG + Intergenic
1191371173 X:59870079-59870101 AAGTGGATATTTGGACCACTGGG + Intergenic
1191371480 X:59874193-59874215 AAGTGGATATTTGGACCACTGGG + Intergenic
1191371931 X:59880367-59880389 AAGTGGATATTTGGACCACTGGG + Intergenic
1191372088 X:59882424-59882446 AAGTGGATATTTGGACCACTGGG + Intergenic
1191372244 X:59884477-59884499 AAGTGGATATTTGGACCACTGGG + Intergenic
1191372535 X:59888251-59888273 AAGTGGATATTTGGACCACTGGG + Intergenic
1191372689 X:59890308-59890330 AAGTGGATATTTGGACCACTGGG + Intergenic
1191372839 X:59892363-59892385 AAGTGGATATTTGGACCACTGGG + Intergenic
1191373146 X:59896478-59896500 AAGTGGATATTTGGACCACTGGG + Intergenic
1191373299 X:59898535-59898557 AAGTGGATATTTGGACCACTGGG + Intergenic
1191373604 X:59902649-59902671 AAGTGGATATTTGGACCACTGGG + Intergenic
1191373764 X:59904706-59904728 AAGTGGATATTTGGACCACTGGG + Intergenic
1191374079 X:59908820-59908842 AAGTGGATATTTGGACCACTGGG + Intergenic
1191374234 X:59910876-59910898 AAGTGGATATTTGGACCACTGGG + Intergenic
1191374703 X:59917047-59917069 AAGTGGATATTTGGACCACTGGG + Intergenic
1191374852 X:59919102-59919124 AAGTGGATATTTGGACCACTGGG + Intergenic
1191375161 X:59923216-59923238 AAGTGGATATTTGGACCACTGGG + Intergenic
1191375313 X:59925273-59925295 AAGTGGATATTTGGACCACTGGG + Intergenic
1191375463 X:59927330-59927352 AAGTGGATATTTGGACCACTGGG + Intergenic
1191375620 X:59929387-59929409 AAGTGGATATTTGGACCACTGGG + Intergenic
1191375778 X:59931443-59931465 AAGTGGATATTTGGACCACTGGG + Intergenic
1191375932 X:59933501-59933523 AAGTGGATATTTGGACCACTGGG + Intergenic
1191376041 X:59935050-59935072 AAGTGGATATTTGGACCACTGGG + Intergenic
1191376197 X:59937107-59937129 AAGTGGATATTTGGACCACTGGG + Intergenic
1191376353 X:59939165-59939187 AAGTGGATATTTGGACCACTGGG + Intergenic
1191376509 X:59941222-59941244 AAGTGGATATTTGGACCACTGGG + Intergenic
1191376662 X:59943279-59943301 AAGTGGATATTTGGACCACTGGG + Intergenic
1191377574 X:59955620-59955642 AAGTGGATATTTGGACCACTGGG + Intergenic
1191377730 X:59957677-59957699 AAGTGGATATTTGGACCACTGGG + Intergenic
1191378189 X:59963855-59963877 AAGTGGATATTTGGACCACTGGG + Intergenic
1191378343 X:59965913-59965935 AAGTGGATATTTGGACCACTGGG + Intergenic
1191378497 X:59967970-59967992 AAGTGGATATTTGGACCACTGGG + Intergenic
1191378954 X:59974146-59974168 AAGTGGATATTTGGACCACTGGG + Intergenic
1191379571 X:59982373-59982395 AAGTGGATATTTGGACCACTGGG + Intergenic
1191379726 X:59984431-59984453 AAGTGGATATTTGGACCACTGGG + Intergenic
1191380037 X:59988549-59988571 AAGTGGATATTTGGACCACTGGG + Intergenic
1191380658 X:59996782-59996804 AAGTGGATATTTGGACCACTGGG + Intergenic
1191381098 X:60002612-60002634 AAGTGGATATTTGGACCACTGGG + Intergenic
1191381250 X:60004670-60004692 AAGTGGATATTTGGACCACTGGG + Intergenic
1191381403 X:60006727-60006749 AAGTGGATATTTGGACCACTGGG + Intergenic
1191381557 X:60008784-60008806 AAGTGGATATTTGGACCACTGGG + Intergenic
1191381866 X:60012898-60012920 AAGTGGATATTTGGACCACTGGG + Intergenic
1191382173 X:60017011-60017033 AAGTGGATATTTGGACCACTGGG + Intergenic
1191382764 X:60024875-60024897 AAGTGGATATTTGGACCACTGGG + Intergenic
1191383068 X:60028989-60029011 AAGTGGATATTTGGACCACTGGG + Intergenic
1191383225 X:60031045-60031067 AAGTGGATATTTGGACCACTGGG + Intergenic
1191383383 X:60033102-60033124 AAGTGGATATTTGGACCACTGGG + Intergenic
1191383536 X:60035160-60035182 AAGTGGATATTTGGACCACTGGG + Intergenic
1191384001 X:60041333-60041355 AAGTGGATATTTGGACCACTGGG + Intergenic
1191384462 X:60047504-60047526 AAGTGGATATTTGGACCACTGGG + Intergenic
1191384617 X:60049562-60049584 AAGTGGATATTTGGACCACTGGG + Intergenic
1191385229 X:60057791-60057813 AAGTGGATATTTGGACCACTGGG + Intergenic
1191385539 X:60061905-60061927 AAGTGGATATTTGGACCACTGGG + Intergenic
1191385692 X:60063962-60063984 AAGTGGATATTTGGACCACTGGG + Intergenic
1191385848 X:60066019-60066041 AAGTGGATATTTGGACCACTGGG + Intergenic
1191386148 X:60070135-60070157 AAGTGGATATTTGGACCACTGGG + Intergenic
1191386456 X:60074249-60074271 AAGTGGATATTTGGACCACTGGG + Intergenic
1191386610 X:60076306-60076328 AAGTGGATATTTGGACCACTGGG + Intergenic
1191386767 X:60078363-60078385 AAGTGGATATTTGGACCACTGGG + Intergenic
1191387363 X:60086423-60086445 AAGTGGATATTTGGACCACTGGG + Intergenic
1191387518 X:60088480-60088502 AAGTGGATATTTGGACCACTGGG + Intergenic
1191387674 X:60090535-60090557 AAGTGGATATTTGGACCACTGGG + Intergenic
1191387818 X:60092421-60092443 AAGTGGATATTTGGACCACTGGG + Intergenic
1191387972 X:60094478-60094500 AAGTGGATATTTGGACCACTGGG + Intergenic
1191388260 X:60098251-60098273 AAGTGGATATTTGGACCACTGGG + Intergenic
1191388413 X:60100308-60100330 AAGTGGATATTTGGACCACTGGG + Intergenic
1191388565 X:60102365-60102387 AAGTGGATATTTGGACCACTGGG + Intergenic
1191388719 X:60104423-60104445 AAGTGGATATTTGGACCACTGGG + Intergenic
1191388860 X:60106309-60106331 AAGTGGATATTTGGACCACTGGG + Intergenic
1191389017 X:60108365-60108387 AAGTGGATATTTGGACCACTGGG + Intergenic
1191389167 X:60110418-60110440 AAGTGGATATTTGGACCACTGGG + Intergenic
1191389472 X:60114530-60114552 AAGTGGATATTTGGACCACTGGG + Intergenic
1191389629 X:60116591-60116613 AAGTGGATATTTGGACCACTGGG + Intergenic
1191389781 X:60118648-60118670 AAGTGGATATTTGGACCACTGGG + Intergenic
1191389932 X:60120706-60120728 AAGTGGATATTTGGACCACTGGG + Intergenic
1191390241 X:60124819-60124841 AAGTGGATATTTGGACCACTGGG + Intergenic
1191390395 X:60126873-60126895 AAGTGGATATTTGGACCACTGGG + Intergenic
1191390843 X:60132875-60132897 AAGTGGATATTTGGACCACTGGG + Intergenic
1191391152 X:60136990-60137012 AAGTGGATATTTGGACCACTGGG + Intergenic
1191391305 X:60139047-60139069 AAGTGGATATTTGGACCACTGGG + Intergenic
1191391613 X:60143160-60143182 AAGTGGATATTTGGACCACTGGG + Intergenic
1191391765 X:60145217-60145239 AAGTGGATATTTGGACCACTGGG + Intergenic
1191392071 X:60149331-60149353 AAGTGGATATTTGGACCACTGGG + Intergenic
1191392539 X:60155503-60155525 AAGTGGATATTTGGACCACTGGG + Intergenic
1191393290 X:60165788-60165810 AAGTGGATATTTGGACCACTGGG + Intergenic
1191393443 X:60167843-60167865 AAGTGGATATTTGGACCACTGGG + Intergenic
1191393599 X:60169900-60169922 AAGTGGATATTTGGACCACTGGG + Intergenic
1191393908 X:60174014-60174036 AAGTGGATATTTGGACCACTGGG + Intergenic
1191394066 X:60176071-60176093 AAGTGGATATTTGGACCACTGGG + Intergenic
1191394217 X:60178128-60178150 AAGTGGATATTTGGACCACTGGG + Intergenic
1191394375 X:60180185-60180207 AAGTGGATATTTGGACCACTGGG + Intergenic
1191394684 X:60184300-60184322 AAGTGGATATTTGGACCACTGGG + Intergenic
1191395144 X:60190475-60190497 AAGTGGATATTTGGACCACTGGG + Intergenic
1191395299 X:60192532-60192554 AAGTGGATATTTGGACCACTGGG + Intergenic
1191395453 X:60194589-60194611 AAGTGGATATTTGGACCACTGGG + Intergenic
1191395609 X:60196646-60196668 AAGTGGATATTTGGACCACTGGG + Intergenic
1191395764 X:60198703-60198725 AAGTGGATATTTGGACCACTGGG + Intergenic
1191395916 X:60200761-60200783 AAGTGGATATTTGGACCACTGGG + Intergenic
1191396066 X:60202819-60202841 AAGTGGATATTTGGACCACTGGG + Intergenic
1191396222 X:60204877-60204899 AAGTGGATATTTGGACCACTGGG + Intergenic
1191396377 X:60206935-60206957 AAGTGGATATTTGGACCACTGGG + Intergenic
1191396532 X:60208992-60209014 AAGTGGATATTTGGACCACTGGG + Intergenic
1191396677 X:60211033-60211055 AAGTGGATATTTGGACCACTGGG + Intergenic
1191397275 X:60219262-60219284 AAGTGGATATTTGGACCACTGGG + Intergenic
1191397423 X:60221319-60221341 AAGTGGATATTTGGACCACTGGG + Intergenic
1191397737 X:60225432-60225454 AAGTGGATATTTGGACCACTGGG + Intergenic
1191397890 X:60227488-60227510 AAGTGGATATTTGGACCACTGGG + Intergenic
1191398045 X:60229546-60229568 AAGTGGATATTTGGACCACTGGG + Intergenic
1191398199 X:60231603-60231625 AAGTGGATATTTGGACCACTGGG + Intergenic
1191398352 X:60233660-60233682 AAGTGGATATTTGGACCACTGGG + Intergenic
1191398508 X:60235718-60235740 AAGTGGATATTTGGACCACTGGG + Intergenic
1191398822 X:60239833-60239855 AAGTGGATATTTGGACCACTGGG + Intergenic
1191398972 X:60241890-60241912 AAGTGGATATTTGGACCACTGGG + Intergenic
1191399127 X:60243947-60243969 AAGTGGATATTTGGACCACTGGG + Intergenic
1191399735 X:60252172-60252194 AAGTGGATATTTGGACCACTGGG + Intergenic
1191400103 X:60257137-60257159 AAGTGGATATTTGGACCACTGGG + Intergenic
1191400259 X:60259194-60259216 AAGTGGATATTTGGACCACTGGG + Intergenic
1191400412 X:60261251-60261273 AAGTGGATATTTGGACCACTGGG + Intergenic
1191400566 X:60263308-60263330 AAGTGGATATTTGGACCACTGGG + Intergenic
1191400877 X:60267423-60267445 AAGTGGATATTTGGACCACTGGG + Intergenic
1191402234 X:60285764-60285786 AAGTGGATATTTGGACCACTGGG + Intergenic
1191402393 X:60287822-60287844 AAGTGGATATTTGGACCACTGGG + Intergenic
1191402525 X:60289538-60289560 AAGTGGATATTTGGACCACTGGG + Intergenic
1191402681 X:60291596-60291618 AAGTGGATATTTGGACCACTGGG + Intergenic
1191402840 X:60293654-60293676 AAGTGGATATTTGGACCACTGGG + Intergenic
1191402996 X:60295710-60295732 AAGTGGATATTTGGACCACTGGG + Intergenic
1191403148 X:60297768-60297790 AAGTGGATATTTGGACCACTGGG + Intergenic
1191403301 X:60299825-60299847 AAGTGGATATTTGGACCACTGGG + Intergenic
1191403458 X:60301882-60301904 AAGTGGATAATTGGACCACTGGG + Intergenic
1191403765 X:60305997-60306019 AAGTGGATATTTGGACCACTGGG + Intergenic
1191404072 X:60310111-60310133 AAGTGGATATTTGGACCACTGGG + Intergenic
1191404380 X:60314225-60314247 AAGTGGATATTTGGACCACTGGG + Intergenic
1191404825 X:60320210-60320232 AAGTGGATATTTGGACCACTGGG + Intergenic
1191405116 X:60324153-60324175 AAGTGGATATTTGGACCACTGGG + Intergenic
1191405268 X:60326208-60326230 AAGTGGATATTTGGACCACTGGG + Intergenic
1191405421 X:60328265-60328287 AAGTGGATATTTGGACCACTGGG + Intergenic
1191405570 X:60330322-60330344 AAGTGGATATTTGGACCACTGGG + Intergenic
1191405716 X:60332207-60332229 AAGTGGATATTTGGACCACTGGG + Intergenic
1191405873 X:60334263-60334285 AAGTGGATATTTGGACCACTGGG + Intergenic
1191406333 X:60340432-60340454 AAGTGGATATTTGGACCACTGGG + Intergenic
1191406486 X:60342488-60342510 AAGTGGATATTTGGACCACTGGG + Intergenic
1191406641 X:60344545-60344567 AAGTGGATATTTGGACCACTGGG + Intergenic
1191406948 X:60348661-60348683 AAGTGGATATTTGGACCACTGGG + Intergenic
1191407408 X:60354832-60354854 AAGTGGATATTTGGACCACTGGG + Intergenic
1191407562 X:60356889-60356911 AAGTGGATATTTGGACCACTGGG + Intergenic
1191408012 X:60363059-60363081 AAGTGGATATTTGGACCACTGGG + Intergenic
1191408165 X:60365117-60365139 AAGTGGATATTTGGACCACTGGG + Intergenic
1191408317 X:60367174-60367196 AAGTGGATATTTGGACCACTGGG + Intergenic
1191408473 X:60369229-60369251 AAGTGGATATTTGGACCACTGGG + Intergenic
1191408631 X:60371286-60371308 AAGTGGATATTTGGACCACTGGG + Intergenic
1191408928 X:60375397-60375419 AAGTGGATATTTGGACCACTGGG + Intergenic
1191409231 X:60379511-60379533 AAGTGGATATTTGGACCACTGGG + Intergenic
1191409536 X:60383629-60383651 AAGTGGATATTTGGACCACTGGG + Intergenic
1191409982 X:60389800-60389822 AAGTGGATATTTGGACCACTGGG + Intergenic
1191410204 X:60392708-60392730 AAGTGGATATTTGGACCACTGGG + Intergenic
1191410668 X:60398879-60398901 AAGTGGATATTTGGACCACTGGG + Intergenic
1191410822 X:60400936-60400958 AAGTGGATATTTGGACCACTGGG + Intergenic
1191411135 X:60405050-60405072 AAGTGGATATTTGGACCACTGGG + Intergenic
1191411290 X:60407107-60407129 AAGTGGATATTTGGACCACTGGG + Intergenic
1191411590 X:60411220-60411242 AAGTGGATATTTGGACCACTGGG + Intergenic
1191412040 X:60417391-60417413 AAGTGGATATTTGGACCACTGGG + Intergenic
1191412505 X:60423562-60423584 AAGTGGATATTTGGACCACTGGG + Intergenic
1191412808 X:60427672-60427694 AAGTGGATATTTGGACCACTGGG + Intergenic
1191413115 X:60431786-60431808 AAGTGGATATTTGGACCACTGGG + Intergenic
1191413270 X:60433843-60433865 AAGTGGATATTTGGACCACTGGG + Intergenic
1191413583 X:60437956-60437978 AAGTGGATATTTGGACCACTGGG + Intergenic
1191414041 X:60444126-60444148 AAGTGGATATTTGGACCACTGGG + Intergenic
1191414194 X:60446183-60446205 AAGTGGATATTTGGACCACTGGG + Intergenic
1191414351 X:60448238-60448260 AAGTGGATATTTGGACCACTGGG + Intergenic
1191414506 X:60450295-60450317 AAGTGGATATTTGGACCACTGGG + Intergenic
1191414812 X:60454409-60454431 AAGTGGATATTTGGTCCACTGGG + Intergenic
1191414968 X:60456466-60456488 AAGTGGATATTTGGACCACTGGG + Intergenic
1191415275 X:60460583-60460605 AAGTGGATATTTGGACCACTGGG + Intergenic
1191415427 X:60462640-60462662 AAGTGGATATTTGGACCACTGGG + Intergenic
1191415739 X:60466755-60466777 AAGTGGATATTTGGACCACTGGG + Intergenic
1191415896 X:60468812-60468834 AAGTGGATATTTGGACCACTGGG + Intergenic
1191416054 X:60470862-60470884 AAGTGGATATTTGGACCACTGGG + Intergenic
1191416209 X:60472920-60472942 AAGTGGATATTTGGACCACTGGG + Intergenic
1191416366 X:60474976-60474998 AAGTGGATATTTGGACCACTGGG + Intergenic
1191416519 X:60477030-60477052 AAGTGGATATTTGGACCACTGGG + Intergenic
1191416675 X:60479089-60479111 AAGTGGATATTTGGACCACTGGG + Intergenic
1191416832 X:60481147-60481169 AAGTGGATATTTGGACCACTGGG + Intergenic
1191416989 X:60483205-60483227 AAGTGGATATTTGGACCACTGGG + Intergenic
1191417139 X:60485262-60485284 AAGTGGATATTTGGACCACTGGG + Intergenic
1191417451 X:60489375-60489397 AAGTGGATATTTGGACCACTGGG + Intergenic
1191417605 X:60491432-60491454 AAGTGGATATTTGGACCACTGGG + Intergenic
1191417758 X:60493489-60493511 AAGTGGATATTTGGACCACTGGG + Intergenic
1191418376 X:60501718-60501740 AAGTGGATATTTGGACCACTGGG + Intergenic
1191418533 X:60503776-60503798 AAGTGGATATTTGGACCACTGGG + Intergenic
1191418996 X:60509949-60509971 AAGTGGATATTTGGACCACTGGG + Intergenic
1191419297 X:60514063-60514085 AAGTGGATATTTGGACCACTGGG + Intergenic
1191420222 X:60526410-60526432 AAGTGGATATTTGGACCACTGGG + Intergenic
1191420530 X:60530524-60530546 AAGTGGATATTTGGACCACTGGG + Intergenic
1191420833 X:60534638-60534660 AAGTGGATATTTGGACCACTGGG + Intergenic
1191420987 X:60536697-60536719 AAGTGGATATTTGGACCACTGGG + Intergenic
1191421299 X:60540811-60540833 AAGTGGATATTTGGACCACTGGG + Intergenic
1191421454 X:60542868-60542890 AAGTGGATATTTGGACCACTGGG + Intergenic
1191421748 X:60546814-60546836 AAGTGGATATTTGGACCACTGGG + Intergenic
1191421904 X:60548871-60548893 AAGTGGATATTTGGACCACTGGG + Intergenic
1191422072 X:60551160-60551182 AAGTGGATATTTGGACCACTGGG + Intergenic
1191422229 X:60553217-60553239 AAGTGGATATTTGGACCACTGGG + Intergenic
1191422538 X:60557335-60557357 AAGTGGATATTTGGACCACTGGG + Intergenic
1191422692 X:60559392-60559414 AAGTGGATATTTGGACCACTGGG + Intergenic
1191422844 X:60561449-60561471 AAGTGGATATTTGGACCACTGGG + Intergenic
1191423149 X:60565563-60565585 AAGTGGATATTTGGACCACTGGG + Intergenic
1191424214 X:60579961-60579983 AAGTGGATATTTGGACCACTGGG + Intergenic
1191424369 X:60582018-60582040 AAGTGGATATTTGGACCACTGGG + Intergenic
1191424526 X:60584075-60584097 AAGTGGATATTTGGACCACTGGG + Intergenic
1191424989 X:60590242-60590264 AAGTGGATATTTGGACCACTGGG + Intergenic
1191425141 X:60592299-60592321 AAGTGGATATTTGGACCACTGGG + Intergenic
1191425598 X:60598472-60598494 AAGTGGATATTTGGACCACTGGG + Intergenic
1191426057 X:60604643-60604665 AAGTGGATATTTGGACCACTGGG + Intergenic
1191426212 X:60606701-60606723 AAGTGGATATTTGGACCACTGGG + Intergenic
1191426367 X:60608758-60608780 AAGTGGATATTTGGACCACTGGG + Intergenic
1191426520 X:60610815-60610837 AAGTGGATATTTGGACCACTGGG + Intergenic
1191426674 X:60612872-60612894 AAGTGGATATTTGGACCACTGGG + Intergenic
1191427281 X:60621101-60621123 AAGTGGATATTTGGACCACTGGG + Intergenic
1191427735 X:60627275-60627297 AAGTGGATATTTGGACCACTGGG + Intergenic
1191427892 X:60629332-60629354 AAGTGGATATTTGGACCACTGGG + Intergenic
1191428199 X:60633442-60633464 AAGTGGATATTTGGACCACTGGG + Intergenic
1191428356 X:60635500-60635522 AAGTGGATATTTGGACCACTGGG + Intergenic
1191428502 X:60637553-60637575 AAGTGGATATTTGGACCACTGGG + Intergenic
1191428658 X:60639610-60639632 AAGTGGATATTTGGACCACTGGG + Intergenic
1191428810 X:60641665-60641687 AAGTGGATATTTGGACCACTGGG + Intergenic
1191428965 X:60643722-60643744 AAGTGGATATTTGGACCACTGGG + Intergenic
1191429272 X:60647833-60647855 AAGTGGATATTTGGACCACTGGG + Intergenic
1191429425 X:60649894-60649916 AAGTGGATATTTGGACCACTGGG + Intergenic
1191429875 X:60656065-60656087 AAGTGGATATTTGGACCACTGGG + Intergenic
1191430024 X:60658122-60658144 AAGTGGATATTTGGACCACTGGG + Intergenic
1191430332 X:60662236-60662258 AAGTGGATATTTGGACCACTGGG + Intergenic
1191430490 X:60664293-60664315 AAGTGGATATTTGGACCACTGGG + Intergenic
1191430645 X:60666350-60666372 AAGTGGATATTTGGACCACTGGG + Intergenic
1191430796 X:60668406-60668428 AAGTGGATATTTGGACCACTGGG + Intergenic
1191430946 X:60670463-60670485 AAGTGGATATTTGGACCACTGGG + Intergenic
1191431396 X:60676633-60676655 AAGTGGATATTTGGACCACTGGG + Intergenic
1191431701 X:60680747-60680769 AAGTGGATATTTGGACCACTGGG + Intergenic
1191432312 X:60688969-60688991 AAGTGGATATTTGGACCACTGGG + Intergenic
1191432919 X:60697199-60697221 AAGTGGATATTTGGACCACTGGG + Intergenic
1191433077 X:60699248-60699270 AAGTGGATATTTGGACCACTGGG + Intergenic
1191433231 X:60701306-60701328 AAGTGGATATTTGGACCACTGGG + Intergenic
1191433367 X:60703024-60703046 AAGTGGATATTTGGACCACTGGG + Intergenic
1191433500 X:60704740-60704762 AAGTGGATATTTGGACCACTGGG + Intergenic
1191433655 X:60706797-60706819 AAGTGGATATTTGGACCACTGGG + Intergenic
1191433950 X:60710743-60710765 AAGTGGATATTTGGACCACTGGG + Intergenic
1191434257 X:60714858-60714880 AAGTGGATATTTGGACCACTGGG + Intergenic
1191434412 X:60716913-60716935 AAGTGGATATTTGGACCACTGGG + Intergenic
1191434569 X:60718969-60718991 AAGTGGATATTTGGACCACTGGG + Intergenic
1191434873 X:60723081-60723103 AAGTGGATATTTGGACCACTGGG + Intergenic
1191435029 X:60725138-60725160 AAGTGGATATTTGGACCACTGGG + Intergenic
1191435185 X:60727195-60727217 AAGTGGATATTTGGACCACTGGG + Intergenic
1191435490 X:60731311-60731333 AAGTGGATATTTGGACCACTGGG + Intergenic
1191435948 X:60737479-60737501 AAGTGGATATTTGGACCACTGGG + Intergenic
1191436105 X:60739536-60739558 AAGTGGATATTTGGACCACTGGG + Intergenic
1191436263 X:60741593-60741615 AAGTGGATATTTGGACCACTGGG + Intergenic
1191436417 X:60743651-60743673 AAGTGGATATTTGGACCACTGGG + Intergenic
1191436872 X:60749823-60749845 AAGTGGATATTTGGACCACTGGG + Intergenic
1191437026 X:60751880-60751902 AAGTGGATATTTGGACCACTGGG + Intergenic
1191437335 X:60755994-60756016 AAGTGGATATTTGGACCACTGGG + Intergenic
1191437637 X:60760109-60760131 AAGTGGATATTTGGACCACTGGG + Intergenic
1191437796 X:60762168-60762190 AAGTGGATATTTGGACCACTGGG + Intergenic
1191437944 X:60764226-60764248 AAGTGGATATTTGGACCACTGGG + Intergenic
1191438251 X:60768339-60768361 AAGTGGATATTTGGACCACTGGG + Intergenic
1191438408 X:60770397-60770419 AAGTGGATATTTGGACCACTGGG + Intergenic
1191438564 X:60772454-60772476 AAGTGGATATTTGGACCACTGGG + Intergenic
1191438718 X:60774511-60774533 AAGTGGATATTTGGACCACTGGG + Intergenic
1191439034 X:60778627-60778649 AAGTGGATATTTGGACCACTGGG + Intergenic
1191439339 X:60782741-60782763 AAGTGGATATTTGGACCACTGGG + Intergenic
1191439495 X:60784798-60784820 AAGTGGATATTTGGTCCACTGGG + Intergenic
1191439647 X:60786855-60786877 AAGTGGATATTTGGACCACTGGG + Intergenic
1191439721 X:60788047-60788069 AAGTGGATATTTGGACCACTGGG + Intergenic
1191439872 X:60790102-60790124 AAGTGGATATTTGGACCACTGGG + Intergenic
1191440028 X:60792159-60792181 AAGTGGATATTTGGACCACTGGG + Intergenic
1191440184 X:60794216-60794238 AAGTGGATATTTGGACCACTGGG + Intergenic
1191440339 X:60796274-60796296 AAGTGGATATTTGGACCACTGGG + Intergenic
1191440493 X:60798335-60798357 AAGTGGATATTTGGACCACTGGG + Intergenic
1191440654 X:60800395-60800417 AAGTGGATATTTGGACCACTGGG + Intergenic
1191440812 X:60802453-60802475 AAGTGGATATTTGGACCACTGGG + Intergenic
1191441123 X:60806570-60806592 AAGTGGATATTTGGACCACTGGG + Intergenic
1191441592 X:60812744-60812766 AAGTGGATATTTGGACCACTGGG + Intergenic
1191441904 X:60816853-60816875 AAGTGGATATTTGGACCACTGGG + Intergenic
1191442206 X:60820966-60820988 AAGTGGATATTTGGACCACTGGG + Intergenic
1191442360 X:60823023-60823045 AAGTGGATATTTGGACCACTGGG + Intergenic
1191442668 X:60827139-60827161 AAGTGGATATTTGGACCACTGGG + Intergenic
1191442822 X:60829198-60829220 AAGTGGATATTTGGACCACTGGG + Intergenic
1191442976 X:60831256-60831278 AAGTGGATATTTGGACCACTGGG + Intergenic
1191443133 X:60833314-60833336 AAGTGGATATTTGGACCACTGGG + Intergenic
1191443448 X:60837430-60837452 AAGTGGATATTTGGACCACTGGG + Intergenic
1191443601 X:60839487-60839509 AAGTGGATATTTGGACCACTGGG + Intergenic
1191443754 X:60841544-60841566 AAGTGGATATTTGGACCACTGGG + Intergenic
1191444214 X:60847715-60847737 AAGTGGATATTTGGACCACTGGG + Intergenic
1191444512 X:60851830-60851852 AAGTGGATATTTGGACCACTGGG + Intergenic
1191444665 X:60853888-60853910 AAGTGGATATTTGGACCACTGGG + Intergenic
1191445269 X:60862116-60862138 AAGTGGATATTTGGACCACTGGG + Intergenic
1191445573 X:60866229-60866251 AAGTGGATATTTGGACCACTGGG + Intergenic
1191445887 X:60870345-60870367 AAGTGGATATTTGGACCACTGGG + Intergenic
1191446043 X:60872404-60872426 AAGTGGATATTTGGACCACTGGG + Intergenic
1191446200 X:60874462-60874484 AAGTGGATATTTGGACCACTGGG + Intergenic
1191446356 X:60876520-60876542 AAGTGGATATTTGGACCACTGGG + Intergenic
1191446507 X:60878575-60878597 AAGTGGATATTTGGACCACTGGG + Intergenic
1191446666 X:60880631-60880653 AAGTGGATATTTGGACCACTGGG + Intergenic
1191446824 X:60882688-60882710 AAGTGGATATTTGGACCACTGGG + Intergenic
1191446981 X:60884745-60884767 AAGTGGATATTTGGACCACTGGG + Intergenic
1191447135 X:60886802-60886824 AAGTGGATATTTGGACCACTGGG + Intergenic
1191447292 X:60888859-60888881 AAGTGGATATTTGGACCACTGGG + Intergenic
1191447601 X:60892974-60892996 AAGTGGATATTTGGACCACTGGG + Intergenic
1191447909 X:60897090-60897112 AAGTGGATATTTGGACCACTGGG + Intergenic
1191448210 X:60901205-60901227 AAGTGGATATTTGGACCACTGGG + Intergenic
1191448516 X:60905319-60905341 AAGTGGATATTTGGACCACTGGG + Intergenic
1191448670 X:60907376-60907398 AAGTGGATATTTGGACCACTGGG + Intergenic
1191448825 X:60909433-60909455 AAGTGGATATTTGGACCACTGGG + Intergenic
1191449123 X:60913546-60913568 AAGTGGATATTTGGACCACTGGG + Intergenic
1191449271 X:60915433-60915455 AAGTGGATATTTGGACCACTGGG + Intergenic
1191449579 X:60919547-60919569 AAGTGGATATTTGGACCACTGGG + Intergenic
1191449886 X:60923667-60923689 AAGTGGATATTTGGACCACTGGG + Intergenic
1191450041 X:60925726-60925748 AAGTGGATATTTGGACCACTGGG + Intergenic
1191450654 X:60933959-60933981 AAGTGGATATTTGGACCACTGGG + Intergenic
1191451111 X:60940128-60940150 AAGTGGATATTTGGACCACTGGG + Intergenic
1191451265 X:60942185-60942207 AAGTGGATATTTGGACCACTGGG + Intergenic
1191451728 X:60948355-60948377 AAGTGGATATTTGGACCACTGGG + Intergenic
1191452032 X:60952473-60952495 AAGTGGATATTTGGACCACTGGG + Intergenic
1191452403 X:60957439-60957461 AAGTGGATATTTGGACCACTGGG + Intergenic
1191452558 X:60959496-60959518 AAGTGGATATTTGGACCACTGGG + Intergenic
1191452719 X:60961553-60961575 AAGTGGATATTTGGACCACTGGG + Intergenic
1191453028 X:60965667-60965689 AAGTGGATATTTGGACCACTGGG + Intergenic
1191453328 X:60969782-60969804 AAGTGGATATTTGGACCACTGGG + Intergenic
1191453480 X:60971840-60971862 AAGTGGATATTTGGACCACTGGG + Intergenic
1191453788 X:60975953-60975975 AAGTGGATATTTGGACCACTGGG + Intergenic
1191453946 X:60978011-60978033 AAGTGGATATTTGGACCACTGGG + Intergenic
1191454101 X:60980068-60980090 AAGTGGATATTTGGACCACTGGG + Intergenic
1191454405 X:60984183-60984205 AAGTGGATATTTGGACCACTGGG + Intergenic
1191455010 X:60992238-60992260 AAGTGGATATTTGGACCACTGGG + Intergenic
1191455165 X:60994295-60994317 AAGTGGATATTTGGACCACTGGG + Intergenic
1191455474 X:60998412-60998434 AAGTGGATATTTGGACCACTGGG + Intergenic
1191455629 X:61000468-61000490 AAGTGGATATTTGGACCACTGGG + Intergenic
1191455941 X:61004585-61004607 AAGTGGATATTTGGACCACTGGG + Intergenic
1191456250 X:61008699-61008721 AAGTGGATATTTGGACCACTGGG + Intergenic
1191456408 X:61010756-61010778 AAGTGGATATTTGGACCACTGGG + Intergenic
1191456561 X:61012817-61012839 AAGTGGATATTTGGACCACTGGG + Intergenic
1191457016 X:61018986-61019008 AAGTGGATATTTGGACCACTGGG + Intergenic
1191457916 X:61031332-61031354 AAGTGGATATTTGGACCACTGGG + Intergenic
1191458072 X:61033389-61033411 AAGTGGATATTTGGACCACTGGG + Intergenic
1191458226 X:61035446-61035468 AAGTGGATATTTGGACCACTGGG + Intergenic
1191458680 X:61041617-61041639 AAGTGGATATTTGGACCACTGGG + Intergenic
1191458834 X:61043673-61043695 AAGTGGATATTTGGACCACTGGG + Intergenic
1191458990 X:61045730-61045752 AAGTGGATATTTGGACCACTGGG + Intergenic
1191459298 X:61049844-61049866 AAGTGGATATTTGGACCACTGGG + Intergenic
1191459760 X:61056015-61056037 AAGTGGATATTTGGACCACTGGG + Intergenic
1191459915 X:61058072-61058094 AAGTGGATATTTGGACCACTGGG + Intergenic
1191460064 X:61060132-61060154 AAGTGGATATTTGGACCACTGGG + Intergenic
1191460216 X:61062187-61062209 AAGTGGATATTTGGACCACTGGG + Intergenic
1191460377 X:61064244-61064266 AAGTGGATATTTGGACCACTGGG + Intergenic
1191460838 X:61070416-61070438 AAGTGGATATTTGGACCACTGGG + Intergenic
1191460994 X:61072475-61072497 AAGTGGATATTTGGACCACTGGG + Intergenic
1191461146 X:61074533-61074555 AAGTGGATATTTGGACCACTGGG + Intergenic
1191461447 X:61078647-61078669 AAGTGGATATTTGGACCACTGGG + Intergenic
1191461604 X:61080704-61080726 AAGTGGATATTTGGACCACTGGG + Intergenic
1191461917 X:61084818-61084840 AAGTGGATATTTGGACCACTGGG + Intergenic
1191462072 X:61086876-61086898 AAGTGGATATTTGGACCACTGGG + Intergenic
1191462226 X:61088931-61088953 AAGTGGATATTTGGACCACTGGG + Intergenic
1191462383 X:61090988-61091010 AAGTGGATATTTGGACCACTGGG + Intergenic
1191462542 X:61093045-61093067 AAGTGGATATTTGGACCACTGGG + Intergenic
1191463159 X:61101275-61101297 AAGTGGATATTTGGACCACTGGG + Intergenic
1191463312 X:61103332-61103354 AAGTGGATATTTGGACCACTGGG + Intergenic
1191463465 X:61105388-61105410 AAGTGGATATTTGGACCACTGGG + Intergenic
1191463621 X:61107445-61107467 AAGTGGATATTTGGACCACTGGG + Intergenic
1191463781 X:61109502-61109524 AAGTGGATATTTGGACCACTGGG + Intergenic
1191463938 X:61111559-61111581 AAGTGGATATTTGGACCACTGGG + Intergenic
1191464240 X:61115670-61115692 AAGTGGATATTTGGACCACTGGG + Intergenic
1191464398 X:61117728-61117750 AAGTGGATATTTGGACCACTGGG + Intergenic
1191464697 X:61121845-61121867 AAGTGGATATTTGGACCACTGGG + Intergenic
1191464850 X:61123902-61123924 AAGTGGATATTTGGACCACTGGG + Intergenic
1191465006 X:61125961-61125983 AAGTGGATATTTGGACCACTGGG + Intergenic
1191465161 X:61128017-61128039 AAGTGGATATTTGGACCACTGGG + Intergenic
1191465311 X:61130072-61130094 AAGTGGATATTTGGACCACTGGG + Intergenic
1191465465 X:61132129-61132151 AAGTGGATATTTGGACCACTGGG + Intergenic
1191465769 X:61136244-61136266 AAGTGGATATTTGGACCACTGGG + Intergenic
1191466742 X:61149435-61149457 AAGTGGATATTTGGACCACTGGG + Intergenic
1191467054 X:61153550-61153572 AAGTGGATATTTGGACCACTGGG + Intergenic
1191467208 X:61155609-61155631 AAGTGGATATTTGGACCACTGGG + Intergenic
1191467513 X:61159724-61159746 AAGTGGATATTTGGACCACTGGG + Intergenic
1191467672 X:61161781-61161803 AAGTGGATATTTGGACCACTGGG + Intergenic
1191467979 X:61165896-61165918 AAGTGGATATTTGGACCACTGGG + Intergenic
1191468279 X:61170009-61170031 AAGTGGATATTTGGACCACTGGG + Intergenic
1191468588 X:61174120-61174142 AAGTGGATATTTGGACCACTGGG + Intergenic
1191468740 X:61176177-61176199 AAGTGGATATTTGGACCACTGGG + Intergenic
1191469414 X:61185258-61185280 AAGTGGATATTTGGACCACTGGG + Intergenic
1191469879 X:61191429-61191451 AAGTGGATATTTGGACCACTGGG + Intergenic
1191470031 X:61193485-61193507 AAGTGGATATTTGGACCACTGGG + Intergenic
1191470490 X:61199658-61199680 AAGTGGATATTTGGACCACTGGG + Intergenic
1191470647 X:61201715-61201737 AAGTGGATATTTGGACCACTGGG + Intergenic
1191471021 X:61206679-61206701 AAGTGGATATTTGGACCACTGGG + Intergenic
1191471654 X:61215085-61215107 AAGTGGATATTTGGACCACTGGG + Intergenic
1191471805 X:61217142-61217164 AAGTGGATATTTGGACCACTGGG + Intergenic
1191471958 X:61219199-61219221 AAGTGGATATTTGGACCACTGGG + Intergenic
1191472258 X:61223313-61223335 AAGTGGATATTTGGACCACTGGG + Intergenic
1191472874 X:61231541-61231563 AAGTGGATATTTGGACCACTGGG + Intergenic
1191473483 X:61239771-61239793 AAGTGGATATTTGGACCACTGGG + Intergenic
1191473777 X:61243714-61243736 AAGTGGATATTTGGACCACTGGG + Intergenic
1191474087 X:61247828-61247850 AAGTGGATATTTGGACCACTGGG + Intergenic
1191474242 X:61249885-61249907 AAGTGGATATTTGGACCACTGGG + Intergenic
1191474549 X:61253999-61254021 AAGTGGATATTTGGACCACTGGG + Intergenic
1191474702 X:61256055-61256077 AAGTGGATATTTGGACCACTGGG + Intergenic
1191474858 X:61258112-61258134 AAGTGGATATTTGGACCACTGGG + Intergenic
1191475766 X:61270453-61270475 AAGTGGATATTTGGACCACTGGG + Intergenic
1191476065 X:61274565-61274587 AAGTGGATATTTGGACCACTGGG + Intergenic
1191476221 X:61276623-61276645 AAGTGGATATTTGGACCACTGGG + Intergenic
1191476375 X:61278680-61278702 AAGTGGATATTTGGACCACTGGG + Intergenic
1191476833 X:61284852-61284874 AAGTGGATATTTGGACCACTGGG + Intergenic
1191476992 X:61286909-61286931 AAGTGGATATTTGGACCACTGGG + Intergenic
1191477302 X:61291027-61291049 AAGTGGATATTTGGACCACTGGG + Intergenic
1191477455 X:61293085-61293107 AAGTGGATATTTGGACCACTGGG + Intergenic
1191477605 X:61295143-61295165 AAGTGGATATTTGGACCACTGGG + Intergenic
1191477756 X:61297031-61297053 AAGTGGATATTTGGACCACTGGG + Intergenic
1191478058 X:61301147-61301169 AAGTGGATATTTGGACCACTGGG + Intergenic
1191478218 X:61303202-61303224 AAGTGGATATTTGGACCACTGGG + Intergenic
1191478368 X:61305257-61305279 AAGTGGATATTTGGACCACTGGG + Intergenic
1191478522 X:61307314-61307336 AAGTGGATATTTGGACCACTGGG + Intergenic
1191478979 X:61313484-61313506 AAGTGGATATTTGGACCACTGGG + Intergenic
1191479292 X:61317599-61317621 AAGTGGATATTTGGACCACTGGG + Intergenic
1191479451 X:61319658-61319680 AAGTGGATATTTGGACCACTGGG + Intergenic
1191479608 X:61321719-61321741 AAGTGGATATTTGGACCACTGGG + Intergenic
1191479765 X:61323774-61323796 AAGTGGATATTTGGACCACTGGG + Intergenic
1191479926 X:61325831-61325853 AAGTGGATATTTGGACCACTGGG + Intergenic
1191480387 X:61332005-61332027 AAGTGGATATTTGGACCACTGGG + Intergenic
1191480679 X:61335949-61335971 AAGTGGATATTTGGACCACTGGG + Intergenic
1191480831 X:61338006-61338028 AAGTGGATATTTGGACCACTGGG + Intergenic
1191480982 X:61340063-61340085 AAGTGGATATTTGGACCACTGGG + Intergenic
1191481141 X:61342120-61342142 AAGTGGATATTTGGACCACTGGG + Intergenic
1191481294 X:61344177-61344199 AAGTGGATATTTGGACCACTGGG + Intergenic
1191481451 X:61346234-61346256 AAGTGGATATTTGGACCACTGGG + Intergenic
1191481749 X:61350348-61350370 AAGTGGATATTTGGACCACTGGG + Intergenic
1191481900 X:61352406-61352428 AAGTGGATATTTGGACCACTGGG + Intergenic
1191482335 X:61358238-61358260 AAGTGGATATTTGGACCACTGGG + Intergenic
1191482490 X:61360295-61360317 AAGTGGATATTTGGACCACTGGG + Intergenic
1191482808 X:61364409-61364431 AAGTGGATATTTGGACCACTGGG + Intergenic
1191482967 X:61366466-61366488 AAGTGGATATTTGGACCACTGGG + Intergenic
1191483405 X:61372472-61372494 AAGTGGATATTTGGACCACTGGG + Intergenic
1191483561 X:61374532-61374554 AAGTGGATATTTGGACCACTGGG + Intergenic
1191483865 X:61378644-61378666 AAGTGGATATTTGGACCACTGGG + Intergenic
1191484017 X:61380698-61380720 AAGTGGATATTTGGACCACTGGG + Intergenic
1191484168 X:61382755-61382777 AAGTGGATATTTGGACCACTGGG + Intergenic
1191484322 X:61384812-61384834 AAGTGGATATTTGGACCACTGGG + Intergenic
1191484630 X:61388927-61388949 AAGTGGATATTTGGACCACTGGG + Intergenic
1191484933 X:61393044-61393066 AAGTGGATATTTGGACCACTGGG + Intergenic
1191486145 X:61409503-61409525 AAGTGGATATTTGGACCACTGGG + Intergenic
1191486295 X:61411560-61411582 AAGTGGATATTTGGACCACTGGG + Intergenic
1191486452 X:61413618-61413640 AAGTGGATATTTGGACCACTGGG + Intergenic
1191486606 X:61415675-61415697 AAGTGGATATTTGGACCACTGGG + Intergenic
1191486748 X:61417561-61417583 AAGTGGATATTTGGACCACTGGG + Intergenic
1191487207 X:61423733-61423755 AAGTGGATATTTGGACCACTGGG + Intergenic
1191487364 X:61425790-61425812 AAGTGGATATTTGGACCACTGGG + Intergenic
1191487517 X:61427849-61427871 AAGTGGATATTTGGACCACTGGG + Intergenic
1191487670 X:61429906-61429928 AAGTGGATATTTGGACCACTGGG + Intergenic
1191487824 X:61431964-61431986 AAGTGGATATTTGGACCACTGGG + Intergenic
1191487976 X:61434021-61434043 AAGTGGATATTTGGACCACTGGG + Intergenic
1191488133 X:61436078-61436100 AAGTGGATATTTGGACCACTGGG + Intergenic
1191488444 X:61440194-61440216 AAGTGGATATTTGGACCACTGGG + Intergenic
1191488603 X:61442251-61442273 AAGTGGATATTTGGACCACTGGG + Intergenic
1191488758 X:61444308-61444330 AAGTGGATATTTGGACCACTGGG + Intergenic
1191488911 X:61446365-61446387 AAGTGGATATTTGGACCACTGGG + Intergenic
1191489065 X:61448421-61448443 AAGTGGATATTTGGACCACTGGG + Intergenic
1191489189 X:61450139-61450161 AAGTGGATATTTGGACCACTGGG + Intergenic
1191490265 X:61464542-61464564 AAGTGGATATTTGGACCACTGGG + Intergenic
1191490418 X:61466600-61466622 AAGTGGATATTTGGACCACTGGG + Intergenic
1191490714 X:61470715-61470737 AAGTGGATATTTGGACCACTGGG + Intergenic
1191491022 X:61474828-61474850 AAGTGGATATTTGGACCACTGGG + Intergenic
1191491179 X:61476890-61476912 AAGTGGATATTTGGACCACTGGG + Intergenic
1191491333 X:61478947-61478969 AAGTGGATATTTGGACCACTGGG + Intergenic
1191491487 X:61481003-61481025 AAGTGGATATTTGGACCACTGGG + Intergenic
1191491642 X:61483060-61483082 AAGTGGATATTTGGACCACTGGG + Intergenic
1191491793 X:61485117-61485139 AAGTGGATATTTGGACCACTGGG + Intergenic
1191491951 X:61487178-61487200 AAGTGGATATTTGGACCACTGGG + Intergenic
1191492104 X:61489235-61489257 AAGTGGATATTTGGACCACTGGG + Intergenic
1191492260 X:61491292-61491314 AAGTGGATATTTGGACCACTGGG + Intergenic
1191492413 X:61493350-61493372 AAGTGGATATTTGGACCACTGGG + Intergenic
1191493029 X:61501578-61501600 AAGTGGATATTTGGACCACTGGG + Intergenic
1191493189 X:61503636-61503658 AAGTGGATATTTGGACCACTGGG + Intergenic
1191493343 X:61505694-61505716 AAGTGGATATTTGGACCACTGGG + Intergenic
1191493498 X:61507751-61507773 AAGTGGATATTTGGACCACTGGG + Intergenic
1191493949 X:61513755-61513777 AAGTGGATATTTGGACCACTGGG + Intergenic
1191494102 X:61515812-61515834 AAGTGGATATTTGGACCACTGGG + Intergenic
1191494235 X:61517527-61517549 AAGTGGATATTTGGACCACTGGG + Intergenic
1191494390 X:61519584-61519606 AAGTGGATATTTGGACCACTGGG + Intergenic
1191494546 X:61521642-61521664 AAGTGGATATTTGGACCACTGGG + Intergenic
1191494698 X:61523700-61523722 AAGTGGATATTTGGACCACTGGG + Intergenic
1191494849 X:61525757-61525779 AAGTGGATATTTGGACCACTGGG + Intergenic
1191494991 X:61527643-61527665 AAGTGGATATTTGGACCACTGGG + Intergenic
1191495145 X:61529676-61529698 AAGTGGATATTTGGACCACTGGG + Intergenic
1191495449 X:61533790-61533812 AAGTGGATATTTGGACCACTGGG + Intergenic
1191495887 X:61539619-61539641 AAGTGGATATTTGGACCACTGGG + Intergenic
1191496042 X:61541676-61541698 AAGTGGATATTTGGACCACTGGG + Intergenic
1191496198 X:61543733-61543755 AAGTGGATATTTGGACCACTGGG + Intergenic
1191496349 X:61545789-61545811 AAGTGGATATTTGGACCACTGGG + Intergenic
1191496663 X:61549903-61549925 AAGTGGATATTTGGACCACTGGG + Intergenic
1191496816 X:61551959-61551981 AAGTGGATATTTGGACCACTGGG + Intergenic
1191496970 X:61554016-61554038 AAGTGGATATTTGGACCACTGGG + Intergenic
1191497127 X:61556076-61556098 AAGTGGATATTTGGACCACTGGG + Intergenic
1191497733 X:61564300-61564322 AAGTGGATATTTGGACCACTGGG + Intergenic
1191498477 X:61574243-61574265 AAGTGGATATTTGGACCACTGGG + Intergenic
1191498788 X:61578357-61578379 AAGTGGATATTTGGACCACTGGG + Intergenic
1191499092 X:61582475-61582497 AAGTGGATATTTGGACCACTGGG + Intergenic
1191499245 X:61584532-61584554 AAGTGGATATTTGGACCACTGGG + Intergenic
1191499403 X:61586589-61586611 AAGTGGATATTTGGACCACTGGG + Intergenic
1191499710 X:61590702-61590724 AAGTGGATATTTGGACCACTGGG + Intergenic
1191499867 X:61592759-61592781 AAGTGGATATTTGGACCACTGGG + Intergenic
1191500018 X:61594819-61594841 AAGTGGATATTTGGACCACTGGG + Intergenic
1191500175 X:61596882-61596904 AAGTGGATATTTGGACCACTGGG + Intergenic
1191500331 X:61598941-61598963 AAGTGGATATTTGGACCACTGGG + Intergenic
1191500945 X:61607169-61607191 AAGTGGATATTTGGACCACTGGG + Intergenic
1191501103 X:61609222-61609244 AAGTGGATATTTGGACCACTGGG + Intergenic
1191501414 X:61613332-61613354 AAGTGGATATTTGGACCACTGGG + Intergenic
1191501727 X:61617446-61617468 AAGTGGATATTTGGACCACTGGG + Intergenic
1191501881 X:61619504-61619526 AAGTGGATATTTGGACCACTGGG + Intergenic
1191502167 X:61623278-61623300 AAGTGGATATTTGGACCACTGGG + Intergenic
1191502323 X:61625335-61625357 AAGTGGATATTTGGACCACTGGG + Intergenic
1191502478 X:61627394-61627416 AAGTGGATATTTGGACCACTGGG + Intergenic
1191502632 X:61629451-61629473 AAGTGGATATTTGGACCACTGGG + Intergenic
1191502785 X:61631509-61631531 AAGTGGATATTTGGACCACTGGG + Intergenic
1191502940 X:61633566-61633588 AAGTGGATATTTGGACCACTGGG + Intergenic
1191503095 X:61635623-61635645 AAGTGGATATTTGGACCACTGGG + Intergenic
1191503251 X:61637679-61637701 AAGTGGATATTTGGACCACTGGG + Intergenic
1191503401 X:61639736-61639758 AAGTGGATATTTGGACCACTGGG + Intergenic
1191503556 X:61641795-61641817 AAGTGGATATTTGGACCACTGGG + Intergenic
1191503711 X:61643852-61643874 AAGTGGATATTTGGACCACTGGG + Intergenic
1191504014 X:61647968-61647990 AAGTGGATATTTGGACCACTGGG + Intergenic
1191504169 X:61650024-61650046 AAGTGGATATTTGGACCACTGGG + Intergenic
1191504469 X:61654140-61654162 AAGTGGATATTTGGACCACTGGG + Intergenic
1191504622 X:61656197-61656219 AAGTGGATATTTGGACCACTGGG + Intergenic
1191504925 X:61660313-61660335 AAGTGGATATTTGGACCACTGGG + Intergenic
1191505082 X:61662370-61662392 AAGTGGATATTTGGACCACTGGG + Intergenic
1191505235 X:61664428-61664450 AAGTGGATATTTGGACCACTGGG + Intergenic
1191505391 X:61666485-61666507 AAGTGGATATTTGGACCACTGGG + Intergenic
1191505547 X:61668542-61668564 AAGTGGATATTTGGACCACTGGG + Intergenic
1191505706 X:61670599-61670621 AAGTGGATATTTGGACCACTGGG + Intergenic
1191505862 X:61672656-61672678 AAGTGGATATTTGGACCACTGGG + Intergenic
1191506169 X:61676768-61676790 AAGTGGATATTTGGACCACTGGG + Intergenic
1191506473 X:61680884-61680906 AAGTGGATATTTGGACCACTGGG + Intergenic
1191506629 X:61682937-61682959 AAGTGGATATTTGGACCACTGGG + Intergenic
1191506786 X:61684993-61685015 AAGTGGATATTTGGACCACTGGG + Intergenic
1191507241 X:61691164-61691186 AAGTGGATATTTGGACCACTGGG + Intergenic
1191507393 X:61693219-61693241 AAGTGGATATTTGGACCACTGGG + Intergenic
1191507542 X:61695276-61695298 AAGTGGATATTTGGACCACTGGG + Intergenic
1191508005 X:61701444-61701466 AAGTGGATATTTGGACCACTGGG + Intergenic
1191508162 X:61703502-61703524 AAGTGGATATTTGGACCACTGGG + Intergenic
1191508779 X:61711732-61711754 AAGTGGATATTTGGACCACTGGG + Intergenic
1191508932 X:61713789-61713811 AAGTGGATATTTGGACCACTGGG + Intergenic
1191509087 X:61715846-61715868 AAGTGGATATTTGGACCACTGGG + Intergenic
1191509245 X:61717903-61717925 AAGTGGATATTTGGACCACTGGG + Intergenic
1191509396 X:61719956-61719978 AAGTGGATATTTGGACCACTGGG + Intergenic
1191509854 X:61726103-61726125 AAGTGGATATTTGGACCACTGGG + Intergenic
1191510009 X:61728160-61728182 AAGTGGATATTTGGACCACTGGG + Intergenic
1191510468 X:61734331-61734353 AAGTGGATATTTGGACCACTGGG + Intergenic
1191510620 X:61736388-61736410 AAGTGGATATTTGGACCACTGGG + Intergenic
1191510772 X:61738445-61738467 AAGTGGATATTTGGACCACTGGG + Intergenic
1191511076 X:61742559-61742581 AAGTGGATATTTGGACCACTGGG + Intergenic
1191511226 X:61744616-61744638 AAGTGGATATTTGGACCACTGGG + Intergenic
1191511534 X:61748731-61748753 AAGTGGATATTTGGACCACTGGG + Intergenic
1191511683 X:61750787-61750809 AAGTGGATATTTGGACCACTGGG + Intergenic
1191511977 X:61754732-61754754 AAGTGGATATTTGGACCACTGGG + Intergenic
1191512281 X:61758847-61758869 AAGTGGATATTTGGACCACTGGG + Intergenic
1191512584 X:61762963-61762985 AAGTGGATATTTGGACCACTGGG + Intergenic
1191512739 X:61765019-61765041 AAGTGGATATTTGGACCACTGGG + Intergenic
1191512889 X:61767076-61767098 AAGTGGATATTTGGACCACTGGG + Intergenic
1191513045 X:61769135-61769157 AAGTGGATATTTGGACCACTGGG + Intergenic
1191513196 X:61771192-61771214 AAGTGGATATTTGGACCACTGGG + Intergenic
1191513354 X:61773249-61773271 AAGTGGATATTTGGACCACTGGG + Intergenic
1191513507 X:61775306-61775328 AAGTGGATATTTGGACCACTGGG + Intergenic
1191513657 X:61777363-61777385 AAGTGGATATTTGGACCACTGGG + Intergenic
1191513814 X:61779420-61779442 AAGTGGATATTTGGACCACTGGG + Intergenic
1191513969 X:61781477-61781499 AAGTGGATATTTGGACCACTGGG + Intergenic
1191514251 X:61785250-61785272 AAGTGGATATTTGGACCACTGGG + Intergenic
1191514866 X:61793479-61793501 AAGTGGATATTTGGACCACTGGG + Intergenic
1191515168 X:61797594-61797616 AAGTGGATATTTGGACCACTGGG + Intergenic
1191515326 X:61799651-61799673 AAGTGGATATTTGGACCACTGGG + Intergenic
1191515785 X:61805826-61805848 AAGTGGATATTTGGACCACTGGG + Intergenic
1191516232 X:61811826-61811848 AAGTGGATATTTGGACCACTGGG + Intergenic
1191516695 X:61817995-61818017 AAGTGGATATTTGGACCACTGGG + Intergenic
1191516849 X:61820053-61820075 AAGTGGATATTTGGACCACTGGG + Intergenic
1191517156 X:61824167-61824189 AAGTGGATATTTGGACCACTGGG + Intergenic
1191517310 X:61826225-61826247 AAGTGGATATTTGGACCACTGGG + Intergenic
1191517777 X:61832403-61832425 AAGTGGATATTTGGACCACTGGG + Intergenic
1191517930 X:61834460-61834482 AAGTGGATATTTGGACCACTGGG + Intergenic
1191518543 X:61842687-61842709 AAGTGGATATTTGGACCACTGGG + Intergenic
1191518698 X:61844743-61844765 AAGTGGATATTTGGACCACTGGG + Intergenic
1191519009 X:61848862-61848884 AAGTGGATATTTGGACCACTGGG + Intergenic
1191519167 X:61850920-61850942 AAGTGGATATTTGGACCACTGGG + Intergenic
1191519320 X:61852977-61852999 AAGTGGATATTTGGACCACTGGG + Intergenic
1191519472 X:61855033-61855055 AAGTGGATATTTGGACCACTGGG + Intergenic
1191519628 X:61857089-61857111 AAGTGGATATTTGGACCACTGGG + Intergenic
1191519784 X:61859146-61859168 AAGTGGATATTTGGACCACTGGG + Intergenic
1191520092 X:61863262-61863284 AAGTGGATATTTGGACCACTGGG + Intergenic
1191520247 X:61865318-61865340 AAGTGGATATTTGGACCACTGGG + Intergenic
1191520547 X:61869431-61869453 AAGTGGATATTTGGACCACTGGG + Intergenic
1191520700 X:61871485-61871507 AAGTGGATATTTGGACCACTGGG + Intergenic
1191521012 X:61875598-61875620 AAGTGGATATTTGGACCACTGGG + Intergenic
1191521166 X:61877656-61877678 AAGTGGATATTTGGACCACTGGG + Intergenic
1191521613 X:61883481-61883503 AAGTGGATATTTGGACCACTGGG + Intergenic
1191521771 X:61885539-61885561 AAGTGGATATTTGGACCACTGGG + Intergenic
1191521926 X:61887596-61887618 AAGTGGATATTTGGACCACTGGG + Intergenic
1191522080 X:61889652-61889674 AAGTGGATATTTGGACCACTGGG + Intergenic
1191522231 X:61891710-61891732 AAGTGGATATTTGGACCACTGGG + Intergenic
1191523130 X:61903885-61903907 AAGTGGATATTTGGACCACTGGG + Intergenic
1191523583 X:61910056-61910078 AAGTGGATATTTGGACCACTGGG + Intergenic
1191523738 X:61912114-61912136 AAGTGGATATTTGGACCACTGGG + Intergenic
1191524199 X:61918285-61918307 AAGTGGATATTTGGACCACTGGG + Intergenic
1191524353 X:61920343-61920365 AAGTGGATATTTGGACCACTGGG + Intergenic
1191524658 X:61924457-61924479 AAGTGGATATTTGGACCACTGGG + Intergenic
1191524959 X:61928570-61928592 AAGTGGATATTTGGACCACTGGG + Intergenic
1191525267 X:61932687-61932709 AAGTGGATATTTGGACCACTGGG + Intergenic
1191525419 X:61934745-61934767 AAGTGGATATTTGGACCACTGGG + Intergenic
1191525573 X:61936803-61936825 AAGTGGATATTTGGACCACTGGG + Intergenic
1191525880 X:61940918-61940940 AAGTGGATATTTGGACCACTGGG + Intergenic
1191526195 X:61945033-61945055 AAGTGGATATTTGGACCACTGGG + Intergenic
1191526352 X:61947090-61947112 AAGTGGATATTTGGACCACTGGG + Intergenic
1191526489 X:61948979-61949001 AAGTGGATATTTGGACCACTGGG + Intergenic
1191526795 X:61953093-61953115 AAGTGGATATTTGGACCACTGGG + Intergenic
1191526953 X:61955150-61955172 AAGTGGATATTTGGACCACTGGG + Intergenic
1191527106 X:61957210-61957232 AAGTGGATATTTGGACCACTGGG + Intergenic
1191527410 X:61961324-61961346 AAGTGGATATTTGGACCACTGGG + Intergenic
1191527564 X:61963382-61963404 AAGTGGATATTTGGACCACTGGG + Intergenic
1191527720 X:61965440-61965462 AAGTGGATATTTGGACCACTGGG + Intergenic
1191527872 X:61967496-61967518 AAGTGGATATTTGGACCACTGGG + Intergenic
1191528023 X:61969556-61969578 AAGTGGATATTTGGACCACTGGG + Intergenic
1191528175 X:61971615-61971637 AAGTGGATATTTGGACCACTGGG + Intergenic
1191528473 X:61975560-61975582 AAGTGGATATTTGGACCACTGGG + Intergenic
1191528934 X:61981726-61981748 AAGTGGATATTTGGACCACTGGG + Intergenic
1191529092 X:61983783-61983805 AAGTGGATATTTGGACCACTGGG + Intergenic
1191529245 X:61985840-61985862 AAGTGGATATTTGGACCACTGGG + Intergenic
1191529527 X:61989615-61989637 AAGTGGATATTTGGACCACTGGG + Intergenic
1191529682 X:61991672-61991694 AAGTGGATATTTGGACCACTGGG + Intergenic
1191529838 X:61993729-61993751 AAGTGGATATTTGGACCACTGGG + Intergenic
1191530094 X:61997161-61997183 AAGTGGATATTTGGACCACTGGG + Intergenic
1191530400 X:62001276-62001298 AAGTGGATATTTGGACCACTGGG + Intergenic
1191530709 X:62005392-62005414 AAGTGGATATTTGGACCACTGGG + Intergenic
1191531016 X:62009505-62009527 AAGTGGATATTTGGACCACTGGG + Intergenic
1191531174 X:62011562-62011584 AAGTGGATATTTGGACCACTGGG + Intergenic
1191531328 X:62013618-62013640 AAGTGGATATTTGGACCACTGGG + Intergenic
1191531646 X:62017733-62017755 AAGTGGATATTTGGACCACTGGG + Intergenic
1191531802 X:62019790-62019812 AAGTGGATATTTGGACCACTGGG + Intergenic
1191531957 X:62021847-62021869 AAGTGGATATTTGGACCACTGGG + Intergenic
1191532572 X:62030077-62030099 AAGTGGATATTTGGACCACTGGG + Intergenic
1191532725 X:62032134-62032156 AAGTGGATATTTGGACCACTGGG + Intergenic
1191533031 X:62036250-62036272 AAGTGGATATTTGGACCACTGGG + Intergenic
1191533186 X:62038308-62038330 AAGTGGATATTTGGACCACTGGG + Intergenic
1191533341 X:62040365-62040387 AAGTGGATATTTGGACCACTGGG + Intergenic
1191533495 X:62042422-62042444 AAGTGGATATTTGGACCACTGGG + Intergenic
1191533780 X:62046196-62046218 AAGTGGATATTTGGACCACTGGG + Intergenic
1191533929 X:62048252-62048274 AAGTGGATATTTGGACCACTGGG + Intergenic
1191534240 X:62052363-62052385 AAGTGGATATTTGGACCACTGGG + Intergenic
1191534393 X:62054419-62054441 AAGTGGATATTTGGACCACTGGG + Intergenic
1191534706 X:62058533-62058555 AAGTGGATATTTGGACCACTGGG + Intergenic
1191535482 X:62069052-62069074 AAGTGGATATTTGGACCACTGGG + Intergenic
1191535633 X:62071110-62071132 AAGTGGATATTTGGACCACTGGG + Intergenic
1191535789 X:62073167-62073189 AAGTGGATATTTGGACCACTGGG + Intergenic
1191535944 X:62075228-62075250 AAGTGGATATTTGGACCACTGGG + Intergenic
1191536095 X:62077285-62077307 AAGTGGATATTTGGACCACTGGG + Intergenic
1191536250 X:62079342-62079364 AAGTGGATATTTGGACCACTGGG + Intergenic
1191536405 X:62081397-62081419 AAGTGGATATTTGGACCACTGGG + Intergenic
1191536560 X:62083459-62083481 AAGTGGATATTTGGACCACTGGG + Intergenic
1191537025 X:62089630-62089652 AAGTGGATATTTGGACCACTGGG + Intergenic
1191537180 X:62091687-62091709 AAGTGGATATTTGGACCACTGGG + Intergenic
1191537331 X:62093744-62093766 AAGTGGATATTTGGACCACTGGG + Intergenic
1191537633 X:62097859-62097881 AAGTGGATATTTGGACCACTGGG + Intergenic
1191537789 X:62099916-62099938 AAGTGGATATTTGGACCACTGGG + Intergenic
1191537939 X:62101971-62101993 AAGTGGATATTTGGACCACTGGG + Intergenic
1191538087 X:62104027-62104049 AAGTGGATATTTGGACCACTGGG + Intergenic
1191538243 X:62106089-62106111 AAGTGGATATTTGGACCACTGGG + Intergenic
1191538559 X:62110403-62110425 AAGTGGATATTTGGACCACTGGG + Intergenic
1191538863 X:62114515-62114537 AAGTGGATATTTGGACCACTGGG + Intergenic
1191539018 X:62116572-62116594 AAGTGGATATTTGGACCACTGGG + Intergenic
1191539173 X:62118627-62118649 AAGTGGATATTTGGACCACTGGG + Intergenic
1191539328 X:62120684-62120706 AAGTGGATATTTGGACCACTGGG + Intergenic
1191539483 X:62122740-62122762 AAGTGGATATTTGGACCACTGGG + Intergenic
1191539636 X:62124798-62124820 AAGTGGATATTTGGACCACTGGG + Intergenic
1191539789 X:62126855-62126877 AAGTGGATATTTGGACCACTGGG + Intergenic
1191539941 X:62128912-62128934 AAGTGGATATTTGGACCACTGGG + Intergenic
1191540247 X:62133026-62133048 AAGTGGATATTTGGACCACTGGG + Intergenic
1191540860 X:62141255-62141277 AAGTGGATATTTGGACCACTGGG + Intergenic
1191541016 X:62143312-62143334 AAGTGGATATTTGGACCACTGGG + Intergenic
1191541171 X:62145369-62145391 AAGTGGATATTTGGACCACTGGG + Intergenic
1191541323 X:62147426-62147448 AAGTGGATATTTGGACCACTGGG + Intergenic
1191541625 X:62151539-62151561 AAGTGGATATTTGGACCACTGGG + Intergenic
1191541931 X:62155659-62155681 AAGTGGATATTTGGACCACTGGG + Intergenic
1191542401 X:62161831-62161853 AAGTGGATATTTGGACCACTGGG + Intergenic
1191542554 X:62163887-62163909 AAGTGGATATTTGGACCACTGGG + Intergenic
1191542860 X:62168005-62168027 AAGTGGATATTTGGACCACTGGG + Intergenic
1191543011 X:62170066-62170088 AAGTGGATATTTGGACCACTGGG + Intergenic
1191543165 X:62172124-62172146 AAGTGGATATTTGGACCACTGGG + Intergenic
1191543321 X:62174182-62174204 AAGTGGATATTTGGACCACTGGG + Intergenic
1191543478 X:62176239-62176261 AAGTGGATATTTGGACCACTGGG + Intergenic
1191543788 X:62180351-62180373 AAGTGGATATTTGGACCACTGGG + Intergenic
1191543941 X:62182408-62182430 AAGTGGATATTTGGACCACTGGG + Intergenic
1191544100 X:62184466-62184488 AAGTGGATATTTGGACCACTGGG + Intergenic
1191544411 X:62188582-62188604 AAGTGGATATTTGGACCACTGGG + Intergenic
1191545166 X:62198869-62198891 AAGTGGATATTTGGACCACTGGG + Intergenic
1191545324 X:62200927-62200949 AAGTGGATATTTGGACCACTGGG + Intergenic
1191545478 X:62202984-62203006 AAGTGGATATTTGGACCACTGGG + Intergenic
1191545633 X:62205042-62205064 AAGTGGATATTTGGACCACTGGG + Intergenic
1191545932 X:62208987-62209009 AAGTGGATATTTGGACCACTGGG + Intergenic
1191546241 X:62213101-62213123 AAGTGGATATTTGGACCACTGGG + Intergenic
1191546390 X:62215160-62215182 AAGTGGATATTTGGACCACTGGG + Intergenic
1191546696 X:62219276-62219298 AAGTGGATATTTGGACCACTGGG + Intergenic
1191546853 X:62221333-62221355 AAGTGGATATTTGGACCACTGGG + Intergenic
1191547008 X:62223390-62223412 AAGTGGATATTTGGACCACTGGG + Intergenic
1191547162 X:62225447-62225469 AAGTGGATATTTGGACCACTGGG + Intergenic
1191547313 X:62227505-62227527 AAGTGGATATTTGGACCACTGGG + Intergenic
1191547469 X:62229562-62229584 AAGTGGATATTTGGACCACTGGG + Intergenic
1191548085 X:62237789-62237811 AAGTGGATATTTGGACCACTGGG + Intergenic
1191548390 X:62241889-62241911 AAGTGGATATTTGGACCACTGGG + Intergenic
1191548540 X:62243948-62243970 AAGTGGATATTTGGACCACTGGG + Intergenic
1191548695 X:62246005-62246027 AAGTGGATATTTGGACCACTGGG + Intergenic
1191548849 X:62248063-62248085 AAGTGGATATTTGGACCACTGGG + Intergenic
1191549152 X:62252179-62252201 AAGTGGATATTTGGACCACTGGG + Intergenic
1191549307 X:62254236-62254258 AAGTGGATATTTGGACCACTGGG + Intergenic
1191549462 X:62256293-62256315 AAGTGGATATTTGGACCACTGGG + Intergenic
1191549923 X:62262461-62262483 AAGTGGATATTTGGACCACTGGG + Intergenic
1191550543 X:62270689-62270711 AAGTGGATATTTGGACCACTGGG + Intergenic
1191551001 X:62276860-62276882 AAGTGGATATTTGGACCACTGGG + Intergenic
1191551155 X:62278918-62278940 AAGTGGATATTTGGACCACTGGG + Intergenic
1191552227 X:62293320-62293342 AAGTGGATATTTGGACCACTGGG + Intergenic
1191552382 X:62295377-62295399 AAGTGGATATTTGGACCACTGGG + Intergenic
1191552846 X:62301547-62301569 AAGTGGATATTTGGACCACTGGG + Intergenic
1191553459 X:62309606-62309628 AAGTGGATATTTGGACCACTGGG + Intergenic
1191553770 X:62313720-62313742 AAGTGGATATTTGGACCACTGGG + Intergenic
1191554078 X:62317836-62317858 AAGTGGATATTTGGACCACTGGG + Intergenic
1191554236 X:62319894-62319916 AAGTGGATATTTGGACCACTGGG + Intergenic
1191554538 X:62324007-62324029 AAGTGGATATTTGGACCACTGGG + Intergenic
1191554996 X:62330179-62330201 AAGTGGATATTTGGACCACTGGG + Intergenic
1191555151 X:62332236-62332258 AAGTGGATATTTGGACCACTGGG + Intergenic
1191555453 X:62336350-62336372 AAGTGGATATTTGGACCACTGGG + Intergenic
1191555908 X:62342516-62342538 AAGTGGATATTTGGACCACTGGG + Intergenic
1191556041 X:62344232-62344254 AAGTGGATATTTGGACCACTGGG + Intergenic
1191556196 X:62346288-62346310 AAGTGGATATTTGGACCACTGGG + Intergenic
1191556351 X:62348344-62348366 AAGTGGATATTTGGACCACTGGG + Intergenic
1191556654 X:62352458-62352480 AAGTGGATATTTGGACCACTGGG + Intergenic
1191556812 X:62354515-62354537 AAGTGGATATTTGGACCACTGGG + Intergenic
1191556968 X:62356572-62356594 AAGTGGATATTTGGACCACTGGG + Intergenic
1191557277 X:62360688-62360710 AAGTGGATATTTGGACCACTGGG + Intergenic
1191557433 X:62362745-62362767 AAGTGGATATTTGGACCACTGGG + Intergenic
1191557584 X:62364802-62364824 AAGTGGATATTTGGACCACTGGG + Intergenic
1191557894 X:62368913-62368935 AAGTGGATATTTGGACCACTGGG + Intergenic
1191558509 X:62377139-62377161 AAGTGGATATTTGGACCACTGGG + Intergenic
1191558666 X:62379197-62379219 AAGTGGATATTTGGACCACTGGG + Intergenic
1191558970 X:62383311-62383333 AAGTGGATATTTGGACCACTGGG + Intergenic
1191559126 X:62385369-62385391 AAGTGGATATTTGGACCACTGGG + Intergenic
1191559438 X:62389484-62389506 AAGTGGATATTTGGACCACTGGG + Intergenic
1191559590 X:62391541-62391563 AAGTGGATATTTGGACCACTGGG + Intergenic
1191560206 X:62399773-62399795 AAGTGGATATTTGGACCACTGGG + Intergenic
1191560360 X:62401831-62401853 AAGTGGATATTTGGACCACTGGG + Intergenic
1191560515 X:62403888-62403910 AAGTGGATATTTGGACCACTGGG + Intergenic
1191560822 X:62408003-62408025 AAGTGGATATTTGGACCACTGGG + Intergenic
1191560973 X:62410059-62410081 AAGTGGATATTTGGACCACTGGG + Intergenic
1191561124 X:62412116-62412138 AAGTGGATATTTGGACCACTGGG + Intergenic
1191561253 X:62463943-62463965 AAGTGGATATTTGGACCACTGGG - Intergenic
1191561410 X:62466000-62466022 AAGTGGATATTTGGACCACTGGG - Intergenic
1191561559 X:62468058-62468080 AAGTGGATATTTGGACCACTGGG - Intergenic
1191561722 X:62470115-62470137 AAGTGGATATTTGGACCACTGGG - Intergenic
1191561875 X:62472171-62472193 AAGTGGATATTTGGACCACTGGG - Intergenic
1191562196 X:62476283-62476305 AAGTGGATATTTGGACCACTGGG - Intergenic
1191562348 X:62478340-62478362 AAGTGGATATTTGGACCACTGGG - Intergenic
1191562502 X:62480397-62480419 AAGTGGATATTTGGACCACTGGG - Intergenic
1191562655 X:62482454-62482476 AAGTGGATATTTGGACCACTGGG - Intergenic
1191563121 X:62488624-62488646 AAGTGGATATTTGGACCACTGGG - Intergenic
1191563421 X:62492738-62492760 AAGTGGATATTTGGACCACTGGG - Intergenic
1191563576 X:62494795-62494817 AAGTGGATATTTGGACCACTGGG - Intergenic
1191563733 X:62496852-62496874 AAGTGGATATTTGGACCACTGGG - Intergenic
1191564191 X:62503021-62503043 AAGTGGATATTTGGACCACTGGG - Intergenic
1191564337 X:62505076-62505098 AAGTGGATATTTGAACCACTGGG - Intergenic
1191571108 X:62621853-62621875 AAGTGGATATTTGGAGCACTTGG + Intergenic
1192133388 X:68574128-68574150 AGCTGGATCCTTTAGTCACTTGG + Intergenic
1193075042 X:77346696-77346718 AAGAGGATACTTCAGTGTCTAGG + Intergenic
1193958474 X:87893509-87893531 AAGTAGGAAGTTGAGTCACTGGG + Intergenic
1199938295 X:152599328-152599350 AAGTAGATGATTGAGTCATTTGG - Intergenic
1201064013 Y:10072547-10072569 AAGTGGATATTTGGAGCACTTGG + Intergenic
1201081359 Y:10252584-10252606 AAGTGGATATTTGTGTCCCCTGG - Intergenic
1201081406 Y:10253438-10253460 AAGTGGATATTTGTGTCCCCTGG - Intergenic
1201081838 Y:10261271-10261293 AAGTGGATATTTGTGTCCCCTGG - Intergenic
1201082150 Y:10266822-10266844 AAGTGGATATTTGTGTCCCCTGG - Intergenic
1201082319 Y:10319946-10319968 AAGTGGATATTTGTGTCCCCTGG + Intergenic
1201082660 Y:10326075-10326097 AAGTGGATATTTGTGTCCCCTGG + Intergenic
1201082981 Y:10331859-10331881 AAGTGGATATTTGTGTCCCCTGG + Intergenic
1201083304 Y:10337648-10337670 AAGTGGATATTTGTGTCCCCTGG + Intergenic
1201083627 Y:10343435-10343457 AAGTGGATATTTGTGTCCCCTGG + Intergenic
1201083948 Y:10349222-10349244 AAGTGGATATTTGTGTCCCCTGG + Intergenic
1201084271 Y:10355014-10355036 AAGTGGATATTTGTGTCCCCTGG + Intergenic
1201084592 Y:10360796-10360818 AAGTGGATATTTGTGTCCCCTGG + Intergenic
1201084895 Y:10366251-10366273 AAGTGGATATTTGTGTCCCCTGG + Intergenic
1201085222 Y:10372211-10372233 AAGTGGATATTTGTGTCCCCTGG + Intergenic
1201085544 Y:10377999-10378021 AAGTGGATATTTGTGTCCCCTGG + Intergenic
1201085867 Y:10383784-10383806 AAGTGGATATTTGTGTCCCCTGG + Intergenic
1201086187 Y:10389570-10389592 AAGTGGATATTTGTGTCCCCTGG + Intergenic
1201086509 Y:10395362-10395384 AAGTGGATATTTGTGTCCCCTGG + Intergenic
1201086834 Y:10401156-10401178 AAGTGGATATTTGTGTCCCCTGG + Intergenic
1201087158 Y:10406941-10406963 AAGTGGATATTTGTGTCCCCTGG + Intergenic
1201087479 Y:10412727-10412749 AAGTGGATATTTGTGTCCCCTGG + Intergenic
1201087800 Y:10418511-10418533 AAGTGGATATTTGTGTCCCCTGG + Intergenic
1201088122 Y:10424298-10424320 AAGTGGATATTTGTGTCCCCTGG + Intergenic
1201088453 Y:10430260-10430282 AAGTGGATATTTGTGTCCCCTGG + Intergenic
1201088756 Y:10435716-10435738 AAGTGGATATTTGTGTCCCCTGG + Intergenic
1201089077 Y:10441499-10441521 AAGTGGATATTTGTGTCCCCTGG + Intergenic
1201089400 Y:10447284-10447306 AAGTGGATATTTGTGTCCCCTGG + Intergenic
1201089722 Y:10453070-10453092 AAGTGGATATTTGTGTCCCCTGG + Intergenic
1201090025 Y:10458521-10458543 AAGTGGATATTTGTGTCCCCTGG + Intergenic
1201090347 Y:10464309-10464331 AAGTGGATATTTGTGTCCCCTGG + Intergenic
1201090670 Y:10470095-10470117 AAGTGGATATTTGTGTCCCCTGG + Intergenic
1201090995 Y:10475880-10475902 AAGTGGATATTTGTGTCCCCTGG + Intergenic
1201091318 Y:10481668-10481690 AAGTGGATATTTGTGTCCCCTGG + Intergenic
1201091642 Y:10487461-10487483 AAGTGGATATTTGTGTCCCCTGG + Intergenic
1201091966 Y:10493246-10493268 AAGTGGATATTTGTGTCCCCTGG + Intergenic
1201092305 Y:10499372-10499394 AAGTGGATATTTGTGTCCCCTGG + Intergenic
1201092628 Y:10505157-10505179 AAGTGGATATTTGTGTCCCCTGG + Intergenic
1201092951 Y:10510945-10510967 AAGTGGATATTTGTGTCCCCTGG + Intergenic
1201093211 Y:10515549-10515571 AAGTGGATATTTGTGTCCCCTGG + Intergenic
1201093534 Y:10521336-10521358 AAGTGGATATTTGTGTCCCCTGG + Intergenic
1201094052 Y:10530694-10530716 AAGTGGATATTTGTGTCCCCTGG + Intergenic
1201094392 Y:10536818-10536840 AAGTGGATATTTGTGTCCCCTGG + Intergenic
1201094717 Y:10542605-10542627 AAGTGGATATTTGTGTCCCCTGG + Intergenic
1201094806 Y:10594117-10594139 AAGTGGATATTTGTGTCCCCTGG - Intergenic
1201095000 Y:10597491-10597513 AAGTGGATATTTGTGTCCCCTGG - Intergenic
1201095328 Y:10603445-10603467 AAGTGGATATTTGTGTCCCCTGG - Intergenic
1201095656 Y:10609402-10609424 AAGTGGATATTTGTGTCCCCTGG - Intergenic
1201095985 Y:10615357-10615379 AAGTGGATATTTGTGTCCCCTGG - Intergenic