ID: 1090640696

View in Genome Browser
Species Human (GRCh38)
Location 11:128726604-128726626
Sequence GAGTCACTTGGCTAGATAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 104}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090640686_1090640696 27 Left 1090640686 11:128726554-128726576 CCGCCTAAGCTCCATACCAATGG 0: 1
1: 0
2: 1
3: 5
4: 60
Right 1090640696 11:128726604-128726626 GAGTCACTTGGCTAGATAGTTGG 0: 1
1: 0
2: 0
3: 8
4: 104
1090640690_1090640696 16 Left 1090640690 11:128726565-128726587 CCATACCAATGGCCTCTGGCCAG 0: 1
1: 0
2: 1
3: 10
4: 165
Right 1090640696 11:128726604-128726626 GAGTCACTTGGCTAGATAGTTGG 0: 1
1: 0
2: 0
3: 8
4: 104
1090640693_1090640696 4 Left 1090640693 11:128726577-128726599 CCTCTGGCCAGAACAAAGTGGAT 0: 1
1: 0
2: 1
3: 10
4: 143
Right 1090640696 11:128726604-128726626 GAGTCACTTGGCTAGATAGTTGG 0: 1
1: 0
2: 0
3: 8
4: 104
1090640685_1090640696 28 Left 1090640685 11:128726553-128726575 CCCGCCTAAGCTCCATACCAATG 0: 1
1: 0
2: 1
3: 5
4: 99
Right 1090640696 11:128726604-128726626 GAGTCACTTGGCTAGATAGTTGG 0: 1
1: 0
2: 0
3: 8
4: 104
1090640683_1090640696 30 Left 1090640683 11:128726551-128726573 CCCCCGCCTAAGCTCCATACCAA 0: 1
1: 0
2: 0
3: 6
4: 54
Right 1090640696 11:128726604-128726626 GAGTCACTTGGCTAGATAGTTGG 0: 1
1: 0
2: 0
3: 8
4: 104
1090640694_1090640696 -3 Left 1090640694 11:128726584-128726606 CCAGAACAAAGTGGATACTTGAG 0: 1
1: 0
2: 1
3: 10
4: 137
Right 1090640696 11:128726604-128726626 GAGTCACTTGGCTAGATAGTTGG 0: 1
1: 0
2: 0
3: 8
4: 104
1090640684_1090640696 29 Left 1090640684 11:128726552-128726574 CCCCGCCTAAGCTCCATACCAAT 0: 1
1: 0
2: 0
3: 6
4: 48
Right 1090640696 11:128726604-128726626 GAGTCACTTGGCTAGATAGTTGG 0: 1
1: 0
2: 0
3: 8
4: 104
1090640688_1090640696 24 Left 1090640688 11:128726557-128726579 CCTAAGCTCCATACCAATGGCCT 0: 1
1: 0
2: 0
3: 9
4: 128
Right 1090640696 11:128726604-128726626 GAGTCACTTGGCTAGATAGTTGG 0: 1
1: 0
2: 0
3: 8
4: 104
1090640691_1090640696 11 Left 1090640691 11:128726570-128726592 CCAATGGCCTCTGGCCAGAACAA 0: 1
1: 0
2: 2
3: 13
4: 196
Right 1090640696 11:128726604-128726626 GAGTCACTTGGCTAGATAGTTGG 0: 1
1: 0
2: 0
3: 8
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090640696 Original CRISPR GAGTCACTTGGCTAGATAGT TGG Intronic
907632143 1:56093224-56093246 CAGTCCTTTGGCTAGAAAGTGGG + Intergenic
911758344 1:101587121-101587143 GAGACACTTGGCTCGATGTTAGG + Intergenic
913118854 1:115721240-115721262 GGGCCACTTGGCTAGATGGAGGG + Intronic
916852804 1:168720694-168720716 GAGCCACTTGTCTAGATCATGGG - Intronic
918243280 1:182638604-182638626 TAGTCACTTGGGTAGATTGGGGG - Intergenic
920222551 1:204414636-204414658 GAACCACTTTTCTAGATAGTTGG - Intergenic
921372930 1:214444033-214444055 TAGACACTTTGCTAGTTAGTGGG - Intronic
1063589217 10:7379305-7379327 GAATCACTTGGTGAGATATTTGG - Intronic
1063941665 10:11136022-11136044 CAGGCACTTGGCTAGATGGTGGG + Intronic
1065928446 10:30457278-30457300 TAGTCACTGGGCTACATAGTAGG + Intronic
1065964664 10:30761452-30761474 GTGTCACATGGCAAGACAGTGGG + Intergenic
1068104632 10:52598691-52598713 GAAACACTTGGATAAATAGTGGG - Intergenic
1069211321 10:65763485-65763507 GAGGCAATTGGCTAAATACTTGG - Intergenic
1069327103 10:67244786-67244808 AAGTCAGTTGGCTTGCTAGTAGG + Intronic
1069574597 10:69517563-69517585 GAGCCACCTGGATAGAGAGTGGG + Intergenic
1074476640 10:113780429-113780451 GACTTACTTGGCTAGTTAGGTGG - Intronic
1074512961 10:114135581-114135603 GAATCAATTGGAAAGATAGTTGG - Intronic
1078791477 11:14546831-14546853 GAGTCAGTTGGATATAGAGTGGG + Intronic
1079149659 11:17886071-17886093 AAGTCACATGGCTAGGAAGTGGG - Intronic
1081576827 11:44323967-44323989 GAGTCACATGGGTAGTGAGTGGG + Intergenic
1085184611 11:74564933-74564955 GAGTCACGTGGCTAAAGAGCAGG + Intronic
1085840900 11:80010816-80010838 GAGTGACTGGGCTTGAGAGTTGG - Intergenic
1086193093 11:84103642-84103664 GTGTCATTTGGCTAGAAAATGGG - Intronic
1089265776 11:117260441-117260463 GAGTCACTTGTATGAATAGTAGG + Intronic
1090640696 11:128726604-128726626 GAGTCACTTGGCTAGATAGTTGG + Intronic
1097964694 12:65566286-65566308 GAGTCACGTGGCAAGTCAGTTGG + Intergenic
1101508058 12:105365759-105365781 GAGACACTTGGTTACATAGTCGG - Intronic
1101517630 12:105451546-105451568 GAATGCCTTGGCTAGATACTGGG + Intergenic
1109551629 13:63910142-63910164 GGATCTCTTGGCTAGAAAGTCGG + Intergenic
1114236871 14:20831748-20831770 GAGTAACTTGGCTTTAAAGTGGG + Intergenic
1119351236 14:73967472-73967494 GAGGCACTTGCTTACATAGTAGG - Intronic
1121893462 14:97621523-97621545 GAGACACTTGGCAAGATACATGG + Intergenic
1125423853 15:39530620-39530642 GAGTCACATGGCTAGAGAGGAGG + Intergenic
1126055797 15:44728736-44728758 GAATCACTTATCTAGAGAGTGGG + Intergenic
1129694858 15:77734814-77734836 GAGTCACTGGGCGAGGTAGGGGG - Intronic
1130714914 15:86324121-86324143 CAGGCACTGGGCTAGATACTAGG + Intronic
1130820963 15:87495324-87495346 GAGTCACTTGTCTATCTATTAGG + Intergenic
1133736126 16:8617131-8617153 GAGCTACTTGGGCAGATAGTAGG + Intergenic
1135269346 16:21055666-21055688 GAGCCACATAGCTAGAAAGTAGG - Intronic
1139316383 16:66073310-66073332 CAGTCACTTTGGAAGATAGTTGG + Intergenic
1145276213 17:21432652-21432674 GATTCACTGGGCTGGATGGTGGG + Intergenic
1145314053 17:21718566-21718588 GATTCACTGGGCTGGATGGTGGG + Intergenic
1150527582 17:65938594-65938616 GAGTAATTTGGCAAGATAATGGG + Intronic
1155164708 18:23222943-23222965 GAGTCACCTGGCTAGTGGGTGGG - Intronic
1156486645 18:37470568-37470590 GCATCACTTGCCTAGACAGTTGG - Intronic
1158618606 18:59010679-59010701 GGGTCACTTGTGTAGAGAGTGGG - Intergenic
1159782415 18:72675507-72675529 GCGTCTCTTGGCTTGATAGAAGG - Intergenic
1164041240 19:21494429-21494451 GAGTCACTGTGCTATATATTTGG + Intergenic
1167496327 19:49821052-49821074 GAGTGGCTTGGCTGGATGGTTGG + Intronic
1168545495 19:57246386-57246408 GAGTCACTTGTCTTGATGGCAGG - Intronic
925979799 2:9167365-9167387 GAGTCTCTTCACTAGATAGTGGG - Intergenic
926129387 2:10292128-10292150 GATTCACATGTCTAGCTAGTTGG + Intergenic
927379572 2:22463273-22463295 GACTCATTTGGCTTGATATTAGG + Intergenic
928319622 2:30272731-30272753 AAGTCACATGGTCAGATAGTGGG - Intronic
932768952 2:74489901-74489923 GAGTCTCTGGGCTGGATAGCTGG + Intronic
933625823 2:84597576-84597598 GAGTCACTTGGTAATATGGTAGG - Intronic
933709949 2:85317486-85317508 GAGTCAGGTGGCAAGAGAGTTGG + Intergenic
938767391 2:134469371-134469393 GAGTCACCTAGCTAGTAAGTGGG - Intronic
940207159 2:151215897-151215919 GAGTCACTTGCCTGCTTAGTGGG + Intergenic
946856959 2:223959852-223959874 GTGTCACGTGGCTAGAAACTTGG + Exonic
1170667073 20:18395478-18395500 GAGTAACCTGGCCAGCTAGTGGG - Intronic
1176408958 21:6437405-6437427 GGCTCACTTGGCTGCATAGTGGG + Intergenic
1179684451 21:43045727-43045749 GGCTCACTTGGCTGCATAGTGGG + Intergenic
1183340522 22:37278143-37278165 GAGTCACTAGGCCAGATGGGAGG - Intergenic
1183658797 22:39206578-39206600 GAGTCACTTGGCTTCACAGACGG + Intergenic
1183712629 22:39514377-39514399 GATACACTTGGCTACCTAGTTGG + Exonic
949438032 3:4050182-4050204 GAGTATCCTGGCTTGATAGTGGG + Intronic
949747963 3:7316726-7316748 GAGATACTTGGATAGATACTTGG - Intronic
951928699 3:27939279-27939301 GTGTCACTTAGCTAGATTGCTGG - Intergenic
955476493 3:59341510-59341532 GAGTCACTTGGAGAGATAGGAGG + Intergenic
956844151 3:73166976-73166998 GACTCACTTGGCTGGCAAGTTGG + Intergenic
956881863 3:73519174-73519196 GAGTCCCTTGGGCAGAAAGTAGG + Intronic
958181372 3:90064715-90064737 TAGTCTCTTGGCTAGACTGTAGG - Intergenic
959511958 3:107223858-107223880 GAGCCACTAGGCTAAATGGTTGG - Intergenic
960183993 3:114616497-114616519 CAGTCATTGTGCTAGATAGTGGG - Intronic
960549630 3:118960189-118960211 GAATTACTGGGCTAGATAATAGG - Intronic
961212668 3:125137810-125137832 GAGTCACTTGGCTCCCTCGTGGG + Intronic
962109546 3:132429737-132429759 GGTTGACTTGGCTAGTTAGTGGG + Intronic
965204915 3:165710090-165710112 GAGTCACCTAGCTGGATGGTTGG + Intergenic
966249258 3:177844448-177844470 GTGTCACTTGGCCTGAGAGTAGG + Intergenic
967286797 3:187879343-187879365 CAGTCTCTTGGCAAGAGAGTAGG - Intergenic
970056167 4:11974991-11975013 AAGTCACTTGGCTAGTAAGCTGG - Intergenic
970591333 4:17562939-17562961 GAGTCACATGGCTAGACTCTTGG - Intergenic
972648854 4:40995998-40996020 GAGCCTCTTAGCTAGATTGTTGG + Intronic
973056770 4:45669225-45669247 TAGTCACATGGCTAGTAAGTGGG - Intergenic
982426932 4:155275174-155275196 GTGTCACTTGGTCAGATATTTGG - Intergenic
983237247 4:165193356-165193378 TAGTCACTTGGCAAGTTAGCTGG - Intronic
990218101 5:53556842-53556864 GAGGGACTAGGCTAGATACTGGG + Intergenic
995595006 5:113738616-113738638 GCCTCACTTGGCTAGATCCTGGG + Intergenic
995646169 5:114314760-114314782 GAGTCACTTGGCAAGTGAGTGGG - Intergenic
997337877 5:133120617-133120639 GATTCACTTGGGTAGAAGGTGGG - Intergenic
998423671 5:142009730-142009752 GAGTTTATTGGCTAGATACTGGG - Intronic
1000137500 5:158367058-158367080 CAGGCACTAGGCTAGATATTTGG - Intergenic
1000321546 5:160138513-160138535 GAGCCACTTGGCTAATAAGTGGG + Intergenic
1002314045 5:178331910-178331932 AAGCCACTTGGCTAGAGGGTGGG + Intronic
1008909490 6:56717783-56717805 GAGGCAGTTGGCTAGACAATGGG - Intronic
1009827744 6:68888956-68888978 GACTCAGATGGCTAGAAAGTGGG + Intronic
1010373974 6:75144763-75144785 CAGTCACTGGGCTAGATGTTGGG - Intronic
1012300744 6:97584956-97584978 GAGTCACATTGATAGATATTAGG + Intergenic
1013609736 6:111783279-111783301 GAGTCACTTGTCATGATATTGGG - Intronic
1018730694 6:166647662-166647684 GAGGCAATTGGCTAAATGGTGGG - Intronic
1031882006 7:127208536-127208558 GAGTAACTTGGCTAATGAGTAGG + Intronic
1035862295 8:3042256-3042278 GAGTCTCTGTGCTAGATAGGAGG - Intronic
1038393236 8:27224916-27224938 GAATCACTTGGCAATATATTAGG - Intergenic
1048851681 8:138651408-138651430 CAGTCAGTTGGTTAGTTAGTTGG - Intronic
1054697481 9:68375046-68375068 CAGTCCCTTGGCTGGAAAGTTGG + Intronic
1057396627 9:94686630-94686652 GAGTCCCTGGGCTAGTGAGTGGG - Intergenic
1059603051 9:115802451-115802473 GATTGACTTGACTACATAGTTGG - Intergenic
1060369102 9:123052250-123052272 AAATCACTTGGCTAGAAAGTGGG - Intronic
1187630187 X:21160702-21160724 CAGTCACTTTGCTAGATGATGGG - Intergenic
1192453198 X:71256121-71256143 AAGTCACCTGGCTAAAAAGTAGG - Intergenic
1193239051 X:79144404-79144426 GAGTTGCTTGCATAGATAGTGGG - Intergenic
1198625711 X:138571060-138571082 CAGTCACATGGCTACAAAGTGGG - Intergenic