ID: 1090640697

View in Genome Browser
Species Human (GRCh38)
Location 11:128726605-128726627
Sequence AGTCACTTGGCTAGATAGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 270}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090640686_1090640697 28 Left 1090640686 11:128726554-128726576 CCGCCTAAGCTCCATACCAATGG 0: 1
1: 0
2: 1
3: 5
4: 60
Right 1090640697 11:128726605-128726627 AGTCACTTGGCTAGATAGTTGGG 0: 1
1: 0
2: 0
3: 15
4: 270
1090640693_1090640697 5 Left 1090640693 11:128726577-128726599 CCTCTGGCCAGAACAAAGTGGAT 0: 1
1: 0
2: 1
3: 10
4: 143
Right 1090640697 11:128726605-128726627 AGTCACTTGGCTAGATAGTTGGG 0: 1
1: 0
2: 0
3: 15
4: 270
1090640691_1090640697 12 Left 1090640691 11:128726570-128726592 CCAATGGCCTCTGGCCAGAACAA 0: 1
1: 0
2: 2
3: 13
4: 196
Right 1090640697 11:128726605-128726627 AGTCACTTGGCTAGATAGTTGGG 0: 1
1: 0
2: 0
3: 15
4: 270
1090640688_1090640697 25 Left 1090640688 11:128726557-128726579 CCTAAGCTCCATACCAATGGCCT 0: 1
1: 0
2: 0
3: 9
4: 128
Right 1090640697 11:128726605-128726627 AGTCACTTGGCTAGATAGTTGGG 0: 1
1: 0
2: 0
3: 15
4: 270
1090640684_1090640697 30 Left 1090640684 11:128726552-128726574 CCCCGCCTAAGCTCCATACCAAT 0: 1
1: 0
2: 0
3: 6
4: 48
Right 1090640697 11:128726605-128726627 AGTCACTTGGCTAGATAGTTGGG 0: 1
1: 0
2: 0
3: 15
4: 270
1090640685_1090640697 29 Left 1090640685 11:128726553-128726575 CCCGCCTAAGCTCCATACCAATG 0: 1
1: 0
2: 1
3: 5
4: 99
Right 1090640697 11:128726605-128726627 AGTCACTTGGCTAGATAGTTGGG 0: 1
1: 0
2: 0
3: 15
4: 270
1090640694_1090640697 -2 Left 1090640694 11:128726584-128726606 CCAGAACAAAGTGGATACTTGAG 0: 1
1: 0
2: 1
3: 10
4: 137
Right 1090640697 11:128726605-128726627 AGTCACTTGGCTAGATAGTTGGG 0: 1
1: 0
2: 0
3: 15
4: 270
1090640690_1090640697 17 Left 1090640690 11:128726565-128726587 CCATACCAATGGCCTCTGGCCAG 0: 1
1: 0
2: 1
3: 10
4: 165
Right 1090640697 11:128726605-128726627 AGTCACTTGGCTAGATAGTTGGG 0: 1
1: 0
2: 0
3: 15
4: 270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090640697 Original CRISPR AGTCACTTGGCTAGATAGTT GGG Intronic
904579419 1:31530011-31530033 AGTCACCTGGCTAGAGATCTTGG + Intergenic
905329533 1:37183284-37183306 AGTCACTTTGGAAGACAGTTTGG + Intergenic
907608512 1:55843809-55843831 AGTGACTTGGCTAGCTGGTGAGG - Intergenic
909388500 1:75089307-75089329 AAACATTTGGCTAGATTGTTAGG - Intergenic
910630297 1:89346855-89346877 AGTGGCTTGGCTAGATGGTCAGG + Intergenic
911760801 1:101613470-101613492 AGGCACTTGGCAGGATAATTTGG + Intergenic
915089525 1:153414680-153414702 AGCCACTTGGGAAGACAGTTTGG + Intergenic
915793370 1:158700221-158700243 AGTCAGTTGGGTACATAGCTTGG + Exonic
916425571 1:164676676-164676698 TGTCACTTAGCTAGCAAGTTAGG - Intronic
916750127 1:167715974-167715996 ATTCACAAGGCTAGATAGGTAGG - Intergenic
919318053 1:195999921-195999943 AGTCATTTGGCTAGATGGTGAGG + Intergenic
920063443 1:203246084-203246106 AGTCACTTTGGAAGACAGTTGGG + Intronic
920667690 1:207976597-207976619 AGTCATTTGCCAAAATAGTTTGG + Intergenic
921693627 1:218181735-218181757 AGTCAGCTGGTTAGATAGTAAGG - Intergenic
922475245 1:225902509-225902531 AGTCCCTTTGGAAGATAGTTTGG + Intronic
924168666 1:241313205-241313227 ATTCTCTTGGCTAGATCTTTTGG - Intronic
924664556 1:246057670-246057692 AGCCACTTGGGAAGACAGTTTGG + Intronic
1062778212 10:173973-173995 GGTCACTTGGGAAGACAGTTTGG + Intronic
1063360005 10:5445478-5445500 AGTCACTATTCTAGATACTTGGG - Intronic
1064015780 10:11771202-11771224 AGTCACTTTGGAAGATAGTCTGG - Intergenic
1065505217 10:26423579-26423601 AGCCACTTGGGAAGACAGTTTGG + Intergenic
1067018822 10:42777639-42777661 AATCAGTTGGCTAAATAGCTAGG + Intergenic
1067049624 10:43006032-43006054 AGTCACTTTGGAAGATAGTCTGG - Intergenic
1068187239 10:53600691-53600713 ACTCACTTGCCTGGATATTTTGG - Intergenic
1068807858 10:61219904-61219926 AGCCACTTTGGCAGATAGTTTGG - Intergenic
1068858484 10:61822216-61822238 AGTGACTTGCCAAGGTAGTTTGG - Intergenic
1069098980 10:64294511-64294533 AGTCACTTTGCAAGACAGTTTGG + Intergenic
1069124794 10:64617148-64617170 AATCACTTTGCTAGCTAGTTTGG - Intergenic
1070412809 10:76159451-76159473 AGCCACTTTGGAAGATAGTTTGG + Intronic
1071009565 10:80922126-80922148 ATTCACTTTGGAAGATAGTTTGG + Intergenic
1071049747 10:81432014-81432036 AGTCACTTTGGAAGACAGTTTGG - Intergenic
1071428967 10:85589954-85589976 AGTCACTTTGGAAGACAGTTTGG + Intergenic
1072863933 10:99038092-99038114 AGTCACTTTGGAAAATAGTTTGG + Intronic
1073039185 10:100588416-100588438 AGCCACTTTGAAAGATAGTTTGG + Intergenic
1073039644 10:100594319-100594341 AGTCACTTTGGAAAATAGTTTGG + Intergenic
1073781327 10:106841997-106842019 AGTCACTTTGGGAGACAGTTTGG - Intronic
1074083459 10:110186647-110186669 AGTCACTTGGTAAAACAGTTTGG - Intergenic
1077494400 11:2879574-2879596 AGCCACTTTGGAAGATAGTTTGG + Intergenic
1079149658 11:17886070-17886092 AGTCACATGGCTAGGAAGTGGGG - Intronic
1079327020 11:19502553-19502575 AATGACTTGCCTAGATAGCTGGG - Intronic
1079746680 11:24140840-24140862 AGTCACTACGCTAGAGGGTTTGG + Intergenic
1081404670 11:42683268-42683290 AGTCACTAGGTGATATAGTTTGG + Intergenic
1081555089 11:44151788-44151810 AGCCACTTTGGAAGATAGTTTGG - Intronic
1084015351 11:66376319-66376341 AGGCACTTTGGAAGATAGTTTGG - Intergenic
1084735115 11:71100183-71100205 AGTCACTTTGGAAGACAGTTTGG + Intronic
1086172768 11:83855234-83855256 AGTCACTTTGGAAGATAGTTTGG + Intronic
1088030462 11:105242421-105242443 AGCCATTTTGCTAAATAGTTGGG + Intergenic
1088947389 11:114528563-114528585 AGTCACTTTGATAGATATTAAGG - Intronic
1090570897 11:128044118-128044140 TGTCACTTGGCTAAATCGGTAGG - Intergenic
1090640697 11:128726605-128726627 AGTCACTTGGCTAGATAGTTGGG + Intronic
1090876765 11:130796995-130797017 AGTCACTTTGGAAAATAGTTTGG + Intergenic
1091892002 12:4064190-4064212 AGTCACTTTGTAAGATAGTTTGG - Intergenic
1092773537 12:11920430-11920452 AGCCACTTTGGAAGATAGTTTGG - Intergenic
1093100097 12:15017748-15017770 AGCCACTTTGGTAGACAGTTTGG + Intergenic
1093222662 12:16441902-16441924 AGCCACTTTGCAAGACAGTTTGG - Intronic
1093538894 12:20256598-20256620 ACTCATTTGGCTAAATACTTAGG + Intergenic
1093928747 12:24934157-24934179 AATCACTTAGGTAGATAGTGAGG - Intronic
1095158218 12:38884605-38884627 AGTCACTTTGGAAAATAGTTTGG - Intronic
1095325825 12:40890918-40890940 AGCCACTTGGGAAGACAGTTTGG - Intronic
1096136183 12:49203545-49203567 AATCACTTAGGCAGATAGTTAGG + Intronic
1101328019 12:103733548-103733570 AGTCATTTGCCTAGAAATTTTGG - Intronic
1101508057 12:105365758-105365780 AGACACTTGGTTACATAGTCGGG - Intronic
1102319965 12:111924483-111924505 AGCCACTTTGGAAGATAGTTTGG + Intergenic
1102790593 12:115641792-115641814 AGCCACTTTGCAAGACAGTTTGG + Intergenic
1102824466 12:115936200-115936222 AGCCACTTTGGAAGATAGTTTGG + Intergenic
1103214475 12:119190955-119190977 AGTCACTTGGTTAGAGACCTTGG + Intronic
1104190225 12:126474858-126474880 AGTCAGTTGGTTAAATACTTAGG - Intergenic
1106299197 13:28448252-28448274 ATTCACTTGGGTAGATACCTAGG - Intronic
1106925015 13:34604948-34604970 AGCTACTTGGCTGGGTAGTTTGG + Intergenic
1107160371 13:37218673-37218695 AGCCACTTTGAAAGATAGTTTGG - Intergenic
1107441952 13:40435759-40435781 ATTCAGTTGCCTAGTTAGTTTGG + Intergenic
1107623354 13:42257286-42257308 AGTCACTTTGGAAAATAGTTTGG - Intergenic
1108316008 13:49238223-49238245 AGTTACTTTGGAAGATAGTTTGG + Intergenic
1108430510 13:50348417-50348439 AGCCACTTAGCTACAGAGTTGGG + Intronic
1109036749 13:57272396-57272418 AGCCACTTGGGAAGACAGTTTGG + Intergenic
1109581932 13:64351352-64351374 AGGCACTTTGGTACATAGTTTGG - Intergenic
1113063644 13:106352508-106352530 AGCCACTTTGGAAGATAGTTTGG + Intergenic
1114457507 14:22865696-22865718 AGTCACTTGGCCAGAGAGCCTGG + Intergenic
1115146331 14:30230186-30230208 AGTCACCTTGCCAGTTAGTTTGG - Intergenic
1115513725 14:34164378-34164400 AGTCACTTTGGAAAATAGTTAGG + Intronic
1115940950 14:38609002-38609024 AGTCACTTGGCAACATCGTTAGG + Intergenic
1116021976 14:39472275-39472297 AGTCACTTTGGAAGACAGTTTGG - Intergenic
1116105164 14:40493467-40493489 ATTCACTTTGCAAGACAGTTTGG - Intergenic
1118108675 14:62691423-62691445 AGTCACTTGAGAAAATAGTTTGG + Intergenic
1119509756 14:75201580-75201602 AGTCAGTGGGCTAGTTTGTTTGG + Intergenic
1120554689 14:85915268-85915290 AGCCACTTTGGAAGATAGTTTGG - Intergenic
1120965843 14:90167011-90167033 AGTCATGTAGCTAGCTAGTTAGG - Intronic
1121197541 14:92087445-92087467 AGTCACTTTGATAGATGGATGGG + Intronic
1125060293 15:35412399-35412421 AGTCACTTTGTAAGACAGTTGGG + Intronic
1126511283 15:49477749-49477771 AGTCACATGGGAAGACAGTTTGG - Intronic
1128404243 15:67318817-67318839 AGTCACTTGGCTAATGATTTAGG + Intronic
1128440375 15:67702068-67702090 AGACACTGGGCTAGGTACTTTGG - Intronic
1128851426 15:70961312-70961334 AGCCACTTTGGAAGATAGTTCGG + Intronic
1129224654 15:74161802-74161824 AGCCACTTGGGAAGATAATTGGG - Intergenic
1130412521 15:83658940-83658962 AGGCACTTGGCCAGAGAGCTAGG - Intronic
1130714915 15:86324122-86324144 AGGCACTGGGCTAGATACTAGGG + Intronic
1132329114 15:100998671-100998693 AGTTGCTTGGATAGATAGATGGG + Intronic
1135501249 16:22997895-22997917 AGTCACCTGGCTTCATAGCTAGG + Intergenic
1135854032 16:25990330-25990352 AGTCACTTTGGAAGACAGTTTGG - Intronic
1137066591 16:35852276-35852298 AATCAGTTGGCTAGATACCTGGG + Intergenic
1137266145 16:46870676-46870698 AGATACTTGGTTAGACAGTTTGG - Intergenic
1139131073 16:64146257-64146279 AGACACATGGATAGATAATTTGG - Intergenic
1147369064 17:39979295-39979317 AGTTACTCTTCTAGATAGTTAGG - Intergenic
1150204904 17:63396236-63396258 AGTCACATGGTTAGATAATGTGG + Intronic
1152860903 17:82696845-82696867 CGTCACATTTCTAGATAGTTCGG - Intronic
1153185306 18:2479594-2479616 AGTCACTTTGAAAGATGGTTTGG + Intergenic
1156075530 18:33274323-33274345 AGTCACTTTGGAAAATAGTTCGG + Intronic
1159127057 18:64235978-64236000 AGTCATTTAGCTTGAAAGTTGGG - Intergenic
1159255246 18:65936723-65936745 AGTCACTTTGTAAAATAGTTGGG + Intergenic
1159907741 18:74112874-74112896 AGTCACTTTGGAAGACAGTTTGG + Intronic
1163227146 19:15971466-15971488 AGTCACTTTGAAAGACAGTTTGG + Intergenic
1164041241 19:21494430-21494452 AGTCACTGTGCTATATATTTGGG + Intergenic
1164699447 19:30273323-30273345 AGCCACGTGGCAAGACAGTTTGG - Intronic
1164893837 19:31851368-31851390 AGTCAGTTGGGTAGATACATAGG - Intergenic
1166217381 19:41344462-41344484 AGTCCATTGGCTAGGTAGCTGGG - Intronic
1166649917 19:44565042-44565064 AGCCACTTGGGAAAATAGTTTGG + Intergenic
1167496328 19:49821053-49821075 AGTGGCTTGGCTGGATGGTTGGG + Intronic
926826845 2:16914232-16914254 AGTGGCTTGGCTGGACAGTTGGG + Intergenic
927396612 2:22658564-22658586 AATCACTTGGCTATATTGTGTGG - Intergenic
928053906 2:28031064-28031086 AGTCAATTGGAAAAATAGTTGGG + Intronic
928471170 2:31577748-31577770 AGTCATTTGGCTTGATACTGAGG - Intronic
929405119 2:41632689-41632711 AGCCACTTTGGAAGATAGTTTGG + Intergenic
933271007 2:80232769-80232791 TGTCACTTCGTTAGATAGCTTGG + Intronic
935432834 2:102994911-102994933 AGTCACTTTGGAAGACAGTTTGG - Intergenic
935506327 2:103908714-103908736 AGCCACTTTGGAAGATAGTTTGG - Intergenic
935633183 2:105229077-105229099 AGCCACTTTGGAAGATAGTTTGG + Intergenic
936696244 2:114952442-114952464 AGCCACGTGGATTGATAGTTGGG + Intronic
937603064 2:123762493-123762515 AGTCACTTGGCTTGGTTGCTGGG + Intergenic
938964324 2:136374737-136374759 AATCACTTGGTAAAATAGTTTGG + Intergenic
938997438 2:136695486-136695508 AATCACTTTGCTAGACAGTAAGG + Intergenic
939733490 2:145814545-145814567 GGTCTCTTGGCTAGTTAGTATGG - Intergenic
940313063 2:152298975-152298997 AGTCACTTTGGAAGACAGTTTGG - Intergenic
940734841 2:157439050-157439072 AGTCAATTAGCTAGATAGAAAGG - Intronic
940852165 2:158698672-158698694 AGTCACTTTGGAAGACAGTTTGG + Intergenic
941212420 2:162657745-162657767 AGTCACTTTGGAAGACAGTTTGG - Intronic
941382080 2:164805904-164805926 AGCCACTTGGGAAGACAGTTTGG - Intronic
945021422 2:205575946-205575968 AGCCACTTTGGAAGATAGTTTGG - Intronic
947036346 2:225861931-225861953 AGTCACTTTGGAAGACAGTTTGG + Intergenic
947921269 2:233876708-233876730 AGCCACTTTGGAAGATAGTTTGG - Intergenic
948191286 2:236061268-236061290 AGCCACTTGGGAAGATAGTCTGG + Intronic
1169156449 20:3334624-3334646 AGTCACTTTGGAAGACAGTTTGG - Intronic
1170205839 20:13797160-13797182 AGGCACTTTGCAAGATAGGTTGG + Intronic
1170449683 20:16469741-16469763 AGTCACTTTGCAAGACAGTTCGG + Intronic
1170689418 20:18599593-18599615 AGCCACTTTGCAAGACAGTTTGG - Intronic
1170871047 20:20206854-20206876 AGTCACTTTGGAAAATAGTTTGG - Intronic
1171319542 20:24229127-24229149 AGCCACTTTGAAAGATAGTTTGG + Intergenic
1171468025 20:25345855-25345877 AGACACTTGGGAAGACAGTTTGG + Intronic
1173453244 20:43184075-43184097 AGTCACTTTGGTAAACAGTTTGG - Intronic
1174016460 20:47492458-47492480 ATTCACTTGGGTATATACTTAGG + Intergenic
1176303674 21:5112433-5112455 AGCCACTTGGGAAGACAGTTTGG + Intergenic
1177320089 21:19509673-19509695 AGTCACTTTGGAAGACAGTTTGG + Intergenic
1177567162 21:22839267-22839289 AGCCACTTTGGAAGATAGTTTGG - Intergenic
1177724112 21:24944847-24944869 AGTCACTTTGCAAGACAGTTTGG + Intergenic
1177862302 21:26468698-26468720 AGCCACTGGGCTAGATACTTTGG + Intronic
1179805992 21:43837422-43837444 AGCCACTTGGGAAGACAGTTTGG + Intergenic
1179853357 21:44149517-44149539 AGCCACTTGGGAAGACAGTTTGG - Intergenic
1183065443 22:35359636-35359658 AGTTAGTTGGATAGATAGGTAGG + Intergenic
1184427336 22:44419072-44419094 AGCCACTTGGGAAGACAGTTTGG + Intergenic
953991564 3:47487927-47487949 AGTCACTTTGGAAAATAGTTTGG - Intergenic
955666619 3:61355933-61355955 AGTCACTTGGCAAGGGAGTCAGG + Intergenic
958775926 3:98482980-98483002 TGTCACTTGGATAAATATTTGGG + Intergenic
959529674 3:107419279-107419301 AGTCACTTCGGAAGACAGTTTGG + Intergenic
959545645 3:107593180-107593202 AGGCACTTTGCTAGATATTATGG + Intronic
960007986 3:112801063-112801085 AGCCACTTGGCTGCATTGTTGGG + Intronic
960227205 3:115182674-115182696 AGCCACTTTGAAAGATAGTTTGG + Intergenic
960492202 3:118331826-118331848 AGTCACATGGTGATATAGTTTGG + Intergenic
965023756 3:163270423-163270445 AGTCACTTTTCTAGAAAATTTGG - Intergenic
965204916 3:165710091-165710113 AGTCACCTAGCTGGATGGTTGGG + Intergenic
965978637 3:174658192-174658214 AGCCACTTGGGAAGACAGTTTGG - Intronic
966452895 3:180082517-180082539 AGCCACTTTGAAAGATAGTTTGG + Intergenic
966858689 3:184215554-184215576 AGCCACTTTGGAAGATAGTTTGG - Intronic
966969865 3:185033693-185033715 AGCCACTTTGGCAGATAGTTTGG - Intronic
969394687 4:6912498-6912520 AGTCACTTGGTTTTATAGATGGG + Intronic
970119427 4:12736216-12736238 AGTCACTTTGGAAGAGAGTTTGG - Intergenic
970463551 4:16300354-16300376 AGTCACTTTGCAAGATGCTTTGG + Intergenic
970703290 4:18769054-18769076 AGTCACTGTGCTAGACAGTGAGG - Intergenic
972074618 4:35070454-35070476 AGTCACTTTGGAAGACAGTTTGG + Intergenic
973539281 4:51920037-51920059 AGTCACATAGCTGGAAAGTTGGG + Intergenic
974268767 4:59622280-59622302 AGCCACTTTGCAAGATAATTTGG + Intergenic
975023788 4:69523837-69523859 ATTATCTTGGCTAGATTGTTTGG + Intronic
975420273 4:74156628-74156650 AGTCACTTTGGAAGACAGTTTGG - Intronic
975958449 4:79871306-79871328 AGCCACTTTGGAAGATAGTTTGG + Intergenic
977589312 4:98808837-98808859 TGTCACTGGGCTGGATAGATGGG + Intergenic
978129458 4:105177696-105177718 AGTCACTTTGGAAGACAGTTTGG + Intronic
979102756 4:116643283-116643305 AGCCACTTCGCAAGATAATTTGG + Intergenic
979115096 4:116813644-116813666 AGTCACTTTGGAAGACAGTTTGG - Intergenic
981511281 4:145561404-145561426 AGTCACCTAGCTAGTTAGTGTGG + Intergenic
982903604 4:161039907-161039929 AGTTACTTAGGTAGATAGTGAGG - Intergenic
982967306 4:161928490-161928512 AGTCACTTTGGAAGACAGTTTGG - Intronic
983237246 4:165193355-165193377 AGTCACTTGGCAAGTTAGCTGGG - Intronic
983400987 4:167265401-167265423 AGCCACTTTGGAAGATAGTTTGG - Intergenic
984297708 4:177874595-177874617 AGTCACTTTGGAAAATAGTTTGG - Intronic
987490111 5:18569546-18569568 AGTACCTTGGCGATATAGTTTGG + Intergenic
987617196 5:20291574-20291596 AGTCACTTGGCTGTATAGAAAGG + Intronic
988792130 5:34618694-34618716 AGTGACTTGGCTGAATAGTAAGG + Intergenic
989279510 5:39624678-39624700 ATTCACATGGCTGGCTAGTTGGG - Intergenic
989711787 5:44407039-44407061 AGTCACTTTGGAAGACAGTTTGG + Intergenic
990154423 5:52858952-52858974 ATTCACTTAGCTATATGGTTAGG - Intronic
995565257 5:113427609-113427631 AGTCACTTTGAAAGGTAGTTTGG + Intronic
996244973 5:121251407-121251429 AGTCATTTTGGTAGATAGATAGG + Intergenic
996849272 5:127934532-127934554 AGTCACTTGGCACTATAGATTGG + Intergenic
996962763 5:129270934-129270956 AGCCACTTTGCAAGACAGTTTGG + Intergenic
999418860 5:151423204-151423226 AGCCACTTTGGAAGATAGTTTGG + Intergenic
999506209 5:152199670-152199692 AGTCACTTTGGAAAATAGTTTGG - Intergenic
1000216802 5:159165996-159166018 AGTCACTTTGGAAGAGAGTTTGG - Intronic
1001762206 5:174217412-174217434 AGCCACTTTGGTAGACAGTTTGG - Intronic
1001887439 5:175307070-175307092 AGTCACTAGGCTAAATAGTATGG + Intergenic
1002993660 6:2261870-2261892 AGACACTTTGGAAGATAGTTCGG - Intergenic
1003490622 6:6618214-6618236 AGACATTTGGCAAGATATTTTGG + Intronic
1007550352 6:42724871-42724893 AGTCACTTTGCAAGACAGATTGG - Intergenic
1007649533 6:43409978-43410000 AGCCACTTTGCAAGACAGTTAGG + Intergenic
1008712965 6:54251035-54251057 AGGCACTTGGCTAGATGTTAAGG - Intronic
1011278038 6:85648667-85648689 AGTCACTTTGGAAGACAGTTTGG + Intergenic
1011597544 6:89030431-89030453 AGTCACTTGGGAAAACAGTTTGG + Intergenic
1011664829 6:89623637-89623659 ACTCACTTGGCTGGCTGGTTTGG + Intronic
1012601623 6:101105463-101105485 TGTCAGTTGGATAGTTAGTTGGG + Intergenic
1014121869 6:117735170-117735192 AGTCACTTTGGAAGACAGTTTGG - Intergenic
1014244701 6:119055460-119055482 AGTCACTTTGGTAAACAGTTTGG - Intronic
1014329814 6:120048945-120048967 AGCCACTTTGGAAGATAGTTTGG - Intergenic
1014489077 6:122039450-122039472 AGCCACTTAGCAAAATAGTTTGG + Intergenic
1014716391 6:124869186-124869208 AGTCACTTTGGAAGACAGTTTGG + Intergenic
1016339543 6:143048288-143048310 AGCCACTTTGGAAGATAGTTTGG + Intergenic
1017231086 6:152074662-152074684 AGCCACTTGGGAAGATGGTTTGG - Intronic
1017413095 6:154190577-154190599 AGCCACTTTGCAAGACAGTTTGG + Intronic
1018061672 6:160094548-160094570 TCTGACTTGGCTCGATAGTTCGG + Intronic
1018589346 6:165400628-165400650 AGTCACTTTGGTAAACAGTTTGG + Intronic
1019867563 7:3726919-3726941 AACCACTTTGCTAGATAGATTGG + Intronic
1022887811 7:34664233-34664255 AGTCACTCTGCTAGATGGTGTGG - Intronic
1024447376 7:49497206-49497228 AGTCCCCTGGCTAGATAGTGTGG - Intergenic
1024717431 7:52095951-52095973 AGTCACTTCGAAAGAAAGTTTGG + Intergenic
1029727946 7:102420299-102420321 AGCCACTTTGCAAGACAGTTTGG - Intronic
1030353443 7:108517323-108517345 AGCCACTTTGAAAGATAGTTCGG + Intronic
1031137401 7:117900105-117900127 AATCACTTAGGTAGATAGTAAGG - Intergenic
1031203420 7:118721510-118721532 AGCCACTTTGTTAGACAGTTTGG - Intergenic
1031924289 7:127623636-127623658 AGTCACTTTGCAAAACAGTTTGG - Intergenic
1032586125 7:133148469-133148491 AGTCACTTTGGAAGACAGTTTGG - Intergenic
1035905163 8:3501990-3502012 AGTCACTTTGGAAGATACTTTGG + Intronic
1036189626 8:6658571-6658593 AAGCACTTGGTTAGAAAGTTGGG - Intergenic
1037148131 8:15599015-15599037 AGGCACTTTGCAAGATGGTTTGG - Intronic
1037515871 8:19631275-19631297 AGCCACTTGGGAAGACAGTTTGG - Intronic
1038351848 8:26783246-26783268 ATTCACTTGGCTGGATAAGTAGG + Intronic
1039345407 8:36698606-36698628 ATTCATTTAGCTAGATATTTAGG - Intergenic
1039838239 8:41274926-41274948 AGCAACTTGGCCATATAGTTAGG + Intronic
1040420519 8:47235828-47235850 AGCCACTTTGGAAGATAGTTTGG + Intergenic
1040642736 8:49358411-49358433 AGCCACTTTGGAAGATAGTTTGG - Intergenic
1041180581 8:55243641-55243663 AGCCACTTTGGAAGATAGTTTGG - Intronic
1041486724 8:58385566-58385588 AGTCACTTTGGAAGACAGTTTGG - Intergenic
1042342495 8:67694921-67694943 AGTGGCTTGGCTGGATGGTTAGG + Intronic
1043315316 8:78914086-78914108 AGTCACTTTGTAAGACAGTTAGG + Intergenic
1043494414 8:80784339-80784361 AGTCACTTTGGAAGACAGTTTGG - Intronic
1045585919 8:103537187-103537209 AAGCACTTGGCTACATAGTTAGG + Intronic
1047583867 8:126247573-126247595 AGTCACTTGGTTAAATAATGAGG + Intergenic
1048686142 8:136907276-136907298 AGACACTTCCCTAGATAGATAGG - Intergenic
1048851680 8:138651407-138651429 AGTCAGTTGGTTAGTTAGTTGGG - Intronic
1050425994 9:5513197-5513219 AGTAACTTGGCTGGACACTTAGG - Intronic
1053621523 9:39824287-39824309 AGTCACATGGGAAGACAGTTTGG + Intergenic
1053883574 9:42620017-42620039 AGTCACATGGGAAGACAGTTTGG - Intergenic
1053889095 9:42674281-42674303 AGTCACATGGGAAGACAGTTTGG + Intergenic
1054222594 9:62427481-62427503 AGTCACATGGGAAGACAGTTTGG - Intergenic
1054228116 9:62481694-62481716 AGTCACATGGGAAGACAGTTTGG + Intergenic
1060721013 9:125977637-125977659 AGTGACTTTGGAAGATAGTTTGG - Intergenic
1060803509 9:126559708-126559730 AGTCACTTTGGAAGACAGTTTGG + Intergenic
1185729823 X:2452386-2452408 AGTCCCTTGGCTACATGCTTAGG - Intronic
1185880855 X:3739612-3739634 AGTCACTTTGGAAGACAGTTTGG + Intergenic
1186032297 X:5381236-5381258 AGTCACTTGACTAAAAGGTTTGG + Intergenic
1187934223 X:24320422-24320444 AGTCACTTTGGAAGAGAGTTTGG - Intergenic
1192588059 X:72336099-72336121 AGTCACTTGGGAAGACATTTTGG - Intronic
1192902845 X:75518550-75518572 AGTCACTGCGGAAGATAGTTTGG + Intronic
1193608268 X:83594806-83594828 TATCACTTGCCTGGATAGTTAGG + Intergenic
1194234745 X:91368667-91368689 AGTCACTTTAGAAGATAGTTTGG - Intergenic
1194808080 X:98355152-98355174 AGTCACTTTGGAAGACAGTTTGG + Intergenic
1194840452 X:98734125-98734147 AGTCACTTTGGAAAATAGTTTGG - Intergenic
1194992420 X:100558972-100558994 AGTCACTTTGGAAGACAGTTTGG + Intergenic
1195317660 X:103694457-103694479 TGTCACTGGGCTAGATACTCTGG + Intergenic
1196264830 X:113630611-113630633 AGCCACTTTGGAAGATAGTTGGG + Intergenic
1196716414 X:118815380-118815402 AGTCACTTTGGAAAATAGTTTGG - Intergenic
1196751598 X:119122602-119122624 AGTCAATTGGTTTGGTAGTTGGG + Intronic
1197015861 X:121625497-121625519 AATCACTTTGAAAGATAGTTTGG + Intergenic
1197987349 X:132279859-132279881 AGCCACTTTGCAAAATAGTTTGG - Intergenic
1198502320 X:137263609-137263631 AGCCACTTTGTAAGATAGTTTGG + Intergenic
1198745743 X:139888654-139888676 AGTCACTTTGAAAAATAGTTGGG + Intronic
1198867321 X:141138184-141138206 AGTCACTTTGAAAGATAGTTTGG + Intergenic
1199410282 X:147513955-147513977 AGTCACTAGGCCAGATAGCAAGG + Intergenic
1200407331 Y:2826293-2826315 AGTTACATGTCTAAATAGTTAGG + Intergenic
1200428073 Y:3044204-3044226 ACTCACTTTGATAGATATTTAGG + Intergenic
1200534923 Y:4384694-4384716 AGACACTGGGCTAGATCCTTTGG - Intergenic