ID: 1090641362

View in Genome Browser
Species Human (GRCh38)
Location 11:128731686-128731708
Sequence TGAAATCTTAAAATAGGAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 452
Summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 411}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090641362_1090641367 5 Left 1090641362 11:128731686-128731708 CCGTCTCCTATTTTAAGATTTCA 0: 1
1: 0
2: 2
3: 38
4: 411
Right 1090641367 11:128731714-128731736 CTTAAGTAGATGGGGCGCAGCGG 0: 1
1: 0
2: 1
3: 9
4: 126
1090641362_1090641365 -4 Left 1090641362 11:128731686-128731708 CCGTCTCCTATTTTAAGATTTCA 0: 1
1: 0
2: 2
3: 38
4: 411
Right 1090641365 11:128731705-128731727 TTCAAAATGCTTAAGTAGATGGG 0: 1
1: 0
2: 0
3: 13
4: 265
1090641362_1090641368 11 Left 1090641362 11:128731686-128731708 CCGTCTCCTATTTTAAGATTTCA 0: 1
1: 0
2: 2
3: 38
4: 411
Right 1090641368 11:128731720-128731742 TAGATGGGGCGCAGCGGCTCAGG 0: 1
1: 0
2: 2
3: 12
4: 148
1090641362_1090641364 -5 Left 1090641362 11:128731686-128731708 CCGTCTCCTATTTTAAGATTTCA 0: 1
1: 0
2: 2
3: 38
4: 411
Right 1090641364 11:128731704-128731726 TTTCAAAATGCTTAAGTAGATGG 0: 1
1: 0
2: 2
3: 33
4: 378
1090641362_1090641366 -3 Left 1090641362 11:128731686-128731708 CCGTCTCCTATTTTAAGATTTCA 0: 1
1: 0
2: 2
3: 38
4: 411
Right 1090641366 11:128731706-128731728 TCAAAATGCTTAAGTAGATGGGG 0: 1
1: 0
2: 1
3: 19
4: 229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090641362 Original CRISPR TGAAATCTTAAAATAGGAGA CGG (reversed) Intronic
901127530 1:6940084-6940106 TGAAATCTTCAACTAGGTGCTGG + Intronic
902951216 1:19884071-19884093 TGAAATATAAAAATAATAGAGGG + Intronic
903105449 1:21075068-21075090 TGAAATAATAAACAAGGAGAGGG + Intronic
903652071 1:24928710-24928732 TGACATCTTAAAATACCAGTGGG - Intronic
905151200 1:35929636-35929658 TGATATTTTAAAATTGGGGAGGG + Intergenic
908087041 1:60646327-60646349 TGAATTTTTAGAATAGCAGAAGG - Intergenic
908247263 1:62237676-62237698 AGAAATCTTAAAATCTGACAGGG - Exonic
909831467 1:80196662-80196684 TGAAATCTTGAAAGAGGTGTGGG + Intergenic
910335428 1:86123886-86123908 AGAAATCATAGAATGGGAGAAGG - Intronic
910523231 1:88147873-88147895 TTAAAACTTTAAATAGGGGAGGG - Intergenic
911597178 1:99810999-99811021 TTGAATGTGAAAATAGGAGATGG + Intergenic
911664060 1:100534393-100534415 TGAAATCTTAAAAAGGAAGCTGG + Intergenic
912227872 1:107756161-107756183 AGACATTTTAAAATAGGTGAAGG - Intronic
912340883 1:108913876-108913898 TGAGATCTTAAAATAGAAAGGGG + Intronic
913954858 1:143279924-143279946 TGAAATCCCAAAATAAAAGAGGG + Intergenic
916152800 1:161812330-161812352 TAAAATCTGAAAATGGGAGCTGG + Intronic
916204847 1:162306502-162306524 GGCAACCGTAAAATAGGAGAGGG + Intronic
916268277 1:162914340-162914362 TGAAAACTAAAAACAGGAGAGGG - Intergenic
916494655 1:165335163-165335185 TGAAAGCTTAAAAGAGAGGAAGG - Intronic
916869596 1:168898649-168898671 TGTAATTTTTAAAAAGGAGAGGG - Intergenic
917660030 1:177169207-177169229 TGAAATGTTAAAATAGCATAAGG - Intergenic
917752600 1:178067247-178067269 TGAAATAATATCATAGGAGAGGG + Intergenic
918594644 1:186279009-186279031 TGAATTCTGAAAATACTAGATGG + Intergenic
918725938 1:187924050-187924072 TGAAATTTAAAAATATGGGATGG - Intergenic
918729692 1:187976095-187976117 TGGAATCTTGAAATAGTGGACGG - Intergenic
919085335 1:192914210-192914232 TCCAATCTTAAAATAGGAGCAGG - Intergenic
919561320 1:199123503-199123525 TAAAATATTAAAATATGTGATGG + Intergenic
919578837 1:199345736-199345758 TGAAATGTTAAAAAAGAAGATGG - Intergenic
920027091 1:203006928-203006950 TGAATTCTCAAAATAGGAGAAGG - Intergenic
920620346 1:207540167-207540189 TGGATTCTTCAAATATGAGAAGG - Intronic
920622128 1:207558724-207558746 TGGATTCTTCAAATATGAGAAGG - Intronic
920987335 1:210902735-210902757 AGAAATCTTAAGAAAGTAGATGG - Intronic
921664038 1:217845273-217845295 AGTGCTCTTAAAATAGGAGAGGG - Intronic
921895591 1:220396563-220396585 TCAAATCTTACAGTAGGAAATGG + Intergenic
922439730 1:225644134-225644156 TAAAATATTAAAATACTAGATGG + Intronic
923655574 1:235913051-235913073 TGAAATTTTAAAAACAGAGATGG + Intergenic
924292056 1:242546774-242546796 TGAAAATTTAAGATAGAAGATGG + Intergenic
924706013 1:246502772-246502794 TGACATCCTAAAAGATGAGATGG - Intronic
1063320712 10:5050335-5050357 TGAAATTTTAAAATCAAAGAAGG + Intronic
1064499307 10:15951655-15951677 TGAATTCTTACAATACCAGATGG + Intergenic
1064814020 10:19235800-19235822 TGAAATTTTGAAGTGGGAGAAGG + Intronic
1065036464 10:21644099-21644121 TGAGATGATAAAATAGGAAAAGG - Intronic
1066335642 10:34474946-34474968 AGAAATGTTAAGATAGGAAAAGG + Intronic
1068189159 10:53627699-53627721 TTAAATCTTAAAGTGAGAGAAGG + Intergenic
1068333339 10:55600849-55600871 AAAAATTTTAAAAAAGGAGAAGG - Intronic
1068536948 10:58250740-58250762 TGAAATCTTAGAAGAAGACAAGG - Intronic
1068832008 10:61506699-61506721 TTAAATCTTAATATATGATAGGG + Intergenic
1073371265 10:102991445-102991467 TGTAATCTTAAAATGGGGCAAGG - Intronic
1074705671 10:116127741-116127763 AGAAGTCTCAAAAGAGGAGAAGG - Intronic
1077649642 11:3958656-3958678 TGAAGTCTTAAAAAAGGAACAGG - Intronic
1077748614 11:4937626-4937648 TAAAATCATAATTTAGGAGAAGG + Intronic
1077811402 11:5641552-5641574 TCAAATCCTAAAATAGGGCATGG + Intronic
1077958268 11:7044807-7044829 TGTAATCTTAAAAATAGAGATGG - Intronic
1078836285 11:15033825-15033847 TGCAATCTCAAAATAAAAGACGG + Intronic
1079668593 11:23136967-23136989 TGAAAAATTAAAAGAGGAGTTGG - Intergenic
1079812715 11:25015429-25015451 TTAGATCCTAAAATAGGAAAAGG - Intronic
1079935901 11:26615663-26615685 TGAAATCTTAAAATATCGAAGGG - Intronic
1082957053 11:58881540-58881562 GGAAAGCTTAGAATAGGAGTTGG - Intronic
1084843618 11:71880545-71880567 TGAAATCCAAACTTAGGAGAAGG - Intronic
1086154529 11:83650927-83650949 TCAAATTTTAAAGAAGGAGAAGG - Intronic
1086285572 11:85245929-85245951 CAAAATCTTAAAAGAGGTGAAGG - Intronic
1087082725 11:94187317-94187339 TCAATTACTAAAATAGGAGAAGG - Intergenic
1087671184 11:101108724-101108746 TTATATCTGAAAAAAGGAGATGG + Intronic
1087892928 11:103555796-103555818 AGAAATAAAAAAATAGGAGAAGG - Intergenic
1088120033 11:106357790-106357812 TTAAAACTAAAAAAAGGAGAAGG - Intergenic
1088635735 11:111818599-111818621 TGACCTCTTAAACTAGGACAGGG + Intronic
1088712614 11:112522107-112522129 TGACATTTAAAAAAAGGAGAAGG + Intergenic
1088948486 11:114539622-114539644 TAAATTCTTAAGATGGGAGATGG + Intronic
1089079897 11:115766800-115766822 TTAAATCTTACAAAAGGAGTAGG - Intergenic
1089371838 11:117966165-117966187 TGAAACCTAAAAAAAGTAGAAGG + Intergenic
1090140683 11:124257277-124257299 TGAGATCTTAAAAAAGGAAGAGG - Intergenic
1090641362 11:128731686-128731708 TGAAATCTTAAAATAGGAGACGG - Intronic
1090728656 11:129550940-129550962 GGTAATCATAAAATAGGGGAAGG - Intergenic
1091868082 12:3860217-3860239 TGAAATGAAAAAATAGTAGATGG + Intronic
1092751147 12:11720136-11720158 TGATATCTGAAGATAGGAAAAGG + Intronic
1093381362 12:18498526-18498548 TGAAATCATAGAACTGGAGAGGG + Intronic
1093971400 12:25379344-25379366 TGAATACATAAAATGGGAGATGG + Intergenic
1096209115 12:49749273-49749295 AGAAATGTTAAAATGTGAGAGGG - Intronic
1097369589 12:58760777-58760799 TGAAATGGTAACATTGGAGAAGG + Intronic
1098348291 12:69529317-69529339 TGACATTTTAAAATACTAGAAGG + Intronic
1099274294 12:80555535-80555557 TCAAATCTTAATTCAGGAGATGG - Intronic
1099674105 12:85734615-85734637 TGAACTCTTAAAAAAAGAAAAGG + Intergenic
1099906540 12:88778029-88778051 TGTCCTCTTAAAAGAGGAGATGG - Intergenic
1099970195 12:89492389-89492411 GAAAACCTTAAAATGGGAGAAGG + Intronic
1100428800 12:94512020-94512042 TGAAATTTTAAATGAGGAGAAGG - Intergenic
1100717371 12:97320049-97320071 TGTAATGTTAAACTAGGAAAAGG - Intergenic
1101306712 12:103535727-103535749 TGAACTCTAAAAATAGCAGTGGG + Intergenic
1101569543 12:105940556-105940578 TGAGATCTTGAAAGAGGGGAGGG - Intergenic
1102501654 12:113357431-113357453 GGAACTCTTAAAATTTGAGAGGG - Intronic
1102509779 12:113406801-113406823 TGAATGTTTAAAACAGGAGAGGG + Intronic
1104764432 12:131317346-131317368 TGAAATATTAAAATAGAGCATGG - Intergenic
1105491177 13:20890150-20890172 TGAAATGTTAAATCAGGAGCTGG + Intronic
1105839388 13:24240608-24240630 TGAAGTCTTAGAATACAAGATGG - Intronic
1106543380 13:30710107-30710129 TGTATTCTTAAAATAGAAGAGGG + Intergenic
1107571553 13:41664743-41664765 CAAAAGCTTAAAATAGGAGGAGG + Intronic
1109303600 13:60615023-60615045 TAAAATTTTAAAATATGAAAGGG - Intergenic
1110094914 13:71505729-71505751 TGAAATCTTAGTATATGAGAAGG - Intronic
1110483391 13:76010229-76010251 TGAATTCTAAAAATAGAAAAAGG + Intergenic
1111883106 13:93983586-93983608 TGCAAACTTAAAGTAGGAGTGGG - Intronic
1112664003 13:101547358-101547380 TCAATTCTTAGAAAAGGAGAAGG - Intronic
1112665228 13:101563258-101563280 TTAAATCCAAAAACAGGAGAAGG + Intronic
1114386854 14:22264458-22264480 AGAAATGTGAAAACAGGAGAAGG + Intergenic
1115148896 14:30260376-30260398 TTAAATCTTATAATATGAGAAGG - Intergenic
1116338453 14:43690544-43690566 TGAAAGATTTTAATAGGAGAAGG - Intergenic
1116491233 14:45505908-45505930 AGAAATCTTAAAATTGGAAAGGG + Intergenic
1117471341 14:56049176-56049198 ATATATCTTAAAATAGTAGAAGG + Intergenic
1117867081 14:60161203-60161225 TAAAATGTTATAATAGGAAAAGG + Intronic
1118542474 14:66843239-66843261 TAAAATGCTAAAATAGCAGATGG - Intronic
1118568003 14:67163908-67163930 TGAACTCTTATCATAGGAGGTGG - Intronic
1118634623 14:67736212-67736234 TAAATTCTAAAAATAGGAAATGG - Intronic
1120511635 14:85422788-85422810 TGAAATTTTAAAAAAATAGATGG + Intergenic
1120604847 14:86561968-86561990 TGAAATCTGGAAATAGTACAGGG - Intergenic
1121231340 14:92361010-92361032 TTTAATCTTTAAAAAGGAGAGGG + Intronic
1121556095 14:94838736-94838758 TAAAGTTTTAAAATAGGAAAAGG - Intergenic
1124838014 15:33214291-33214313 TGAAACCTTAAAATAGAACACGG - Intergenic
1126407934 15:48341027-48341049 TGCCAGCTTAAAATAGGAAATGG + Intronic
1126918538 15:53493766-53493788 TGAAATCTCAACCTAGGAGCAGG + Intergenic
1127571612 15:60248875-60248897 TTAAATCTCAAAATAAGAAAGGG - Intergenic
1128228040 15:66016048-66016070 TCAAATCATAGAATGGGAGAGGG + Intronic
1128428809 15:67571583-67571605 AAAAATCTTGAAATAGGAAATGG - Intronic
1128878532 15:71222269-71222291 TGAAGTCCTCAAATAAGAGAGGG - Intronic
1129066645 15:72910366-72910388 GGTAAACTTAAAATAGGAGTGGG + Intergenic
1130391858 15:83463706-83463728 TCAAATATTTAAATAGGACAGGG - Intronic
1134286655 16:12867861-12867883 CGAAGTCTTAAGAGAGGAGACGG - Intergenic
1134877942 16:17718891-17718913 TGACATCTTAAAGGAAGAGAGGG + Intergenic
1135282434 16:21164224-21164246 AAAAATTTTAAAAAAGGAGATGG - Intronic
1135381545 16:22000224-22000246 ATAAATCTTAAAATAGCATATGG - Intronic
1135715763 16:24765058-24765080 TGAAATCTTGGAAAAGGAGGGGG + Intronic
1135846063 16:25919617-25919639 GCAAATCTTAAAATAGCAGGGGG + Intronic
1135885884 16:26307318-26307340 TGAGAATTTAAAAAAGGAGAGGG - Intergenic
1136231399 16:28887669-28887691 GGCAATCTTAAAGTAGTAGATGG - Exonic
1136654592 16:31702423-31702445 GGCATTCTTGAAATAGGAGATGG + Intergenic
1137800868 16:51260766-51260788 TGCAATTTTAAAAGAGGAGGAGG - Intergenic
1138137316 16:54534484-54534506 TGAAATCTTAAAAGGGGAGTCGG - Intergenic
1138627761 16:58266103-58266125 TGAGGTCTGAAAATAGGAGTGGG + Intronic
1138777162 16:59736957-59736979 TGAGATCTAAAAACAGAAGATGG - Intronic
1140194076 16:72842613-72842635 CAAAATCTTCAAATAGGAGGAGG + Intronic
1140853714 16:78958777-78958799 TTTAATCTGAAAATAGGACATGG + Intronic
1141834377 16:86528995-86529017 AGAAATTTTAGAATATGAGAAGG - Intergenic
1143236405 17:5404972-5404994 TGAATGCTTAATATATGAGAAGG - Intronic
1143281382 17:5757179-5757201 AGAAAACTTAAAGTAAGAGAGGG - Intergenic
1144034029 17:11349362-11349384 TGAAATCATAGAATCTGAGAGGG - Intronic
1144413735 17:15025692-15025714 TGAAAAATTAAAATAAGAGGAGG - Intergenic
1145044061 17:19598522-19598544 TGTAAGATTAAAATATGAGAAGG - Intergenic
1146776297 17:35620362-35620384 TGTAATCTTGAACTAGCAGATGG - Intronic
1148339249 17:46863630-46863652 TCAAATGTTAAAAAAGGACATGG + Intronic
1149667772 17:58377846-58377868 TAAAATCTGAAAAGAGGAAATGG - Intronic
1150601195 17:66652549-66652571 AGAAATCTGAAAATAGGACCAGG + Intronic
1150606465 17:66695303-66695325 TGAAATCTGAAGCTTGGAGAAGG - Intronic
1151895735 17:76979624-76979646 TGAAATTTTAAAATAGAAACAGG + Intergenic
1155576613 18:27254730-27254752 GGAAAACTTAAAAGAGAAGAGGG + Intergenic
1155673570 18:28402197-28402219 ACAAATCTTAAGATAGGAGTTGG + Intergenic
1156208623 18:34913722-34913744 TGACTTCTTAAAAGAGGTGAAGG - Intergenic
1156885149 18:42126780-42126802 TGAAATGTTGCAATGGGAGAAGG - Intergenic
1157103811 18:44754514-44754536 TGAAATCATAGAATAGGCCAGGG + Intronic
1157279655 18:46337757-46337779 TCAAATCTTACAATGGGAGGTGG - Intronic
1158026106 18:52899135-52899157 ATAAATAATAAAATAGGAGAAGG - Intronic
1159015722 18:63100396-63100418 TGAAAACTAAAAATAAGAGATGG - Intergenic
1159283831 18:66323313-66323335 GGAAATCTTAGAATAGGATAGGG + Intergenic
1159326809 18:66931003-66931025 TGCAATCTTAGACTAGGTGAGGG - Intergenic
1159771030 18:72545066-72545088 TGAAATCTTCAAAGGGGAGAGGG - Intronic
1159988922 18:74879082-74879104 ATAAATCTTAAAATAGGGAAAGG + Intronic
1160152182 18:76403772-76403794 GGAAATCTGTCAATAGGAGAAGG - Intronic
1162662789 19:12183430-12183452 TGAAATCACAAAAAAGGAGCTGG - Intronic
1164235531 19:23329919-23329941 AGAAATCTTAAGGTAGAAGATGG - Intronic
1164300759 19:23960596-23960618 CGAAATCTTAATGTAGGAGATGG + Intergenic
1164322762 19:24165218-24165240 AGAAATCTTAATGTAGGAGATGG + Intergenic
1167068692 19:47206426-47206448 GGAAAGCTTACACTAGGAGATGG + Intronic
1167706526 19:51084392-51084414 TGGAAATTCAAAATAGGAGACGG + Intergenic
1167740960 19:51324778-51324800 AGAAATGTTCAAATGGGAGAGGG + Intronic
1167876069 19:52413698-52413720 TGAAAACAAAAAACAGGAGAGGG - Intronic
1168259983 19:55187890-55187912 TGAAATCTTAAAATAATGGTGGG - Intronic
925425237 2:3743988-3744010 TGGACTCTAAAAATGGGAGAAGG + Intronic
925529989 2:4849050-4849072 TGTAGTCTTAGAATTGGAGATGG + Intergenic
926794590 2:16608435-16608457 TGCGATCTTAAAATAGATGAGGG - Intronic
927335788 2:21922711-21922733 AGAAAGCTTAAAATAAGGGATGG + Intergenic
928107044 2:28477218-28477240 TCAAATCTTAAAATGGGGCAAGG + Intronic
928266719 2:29818319-29818341 AGAAATCTAAAAATAGGCCAGGG - Intronic
929099503 2:38297007-38297029 TGATATCTTCTAATAGAAGATGG - Intronic
930257594 2:49109811-49109833 TAAAATTTTAAATTAGGAAAAGG + Intronic
930892085 2:56401700-56401722 TGATATGTTAAAATATAAGAAGG - Intergenic
931635932 2:64340797-64340819 TGAAATATTCAAACAGGAGTGGG + Intergenic
932059976 2:68486653-68486675 TGTAATGTAAAACTAGGAGATGG - Intronic
933936993 2:87214339-87214361 TGCTTTCTTAAAATAAGAGAGGG - Intergenic
935173346 2:100627754-100627776 TTAAATATGAAAATAGGATAAGG + Intergenic
935461864 2:103345970-103345992 TGAAATATTTAAATAACAGAAGG - Intergenic
936279911 2:111129592-111129614 TGAAATCTCAATACAGTAGATGG - Intronic
936356149 2:111751485-111751507 TGCTTTCTTAAAATAAGAGAGGG + Intergenic
936678129 2:114739037-114739059 TGAAACCTCAAACTAGGAAATGG - Intronic
936850320 2:116888884-116888906 TGAAATCTAAAAACAGAAGTAGG - Intergenic
937786531 2:125905761-125905783 TGAAGTCTTAAAATAGGAATGGG + Intergenic
938152278 2:128897684-128897706 CACAATCTTAAAATTGGAGATGG - Intergenic
938909605 2:135874633-135874655 TGAAAATTTAAAATATGAAATGG + Intronic
939436776 2:142187035-142187057 TGAAATCTTAAAAAAAAAGAGGG - Intergenic
939507263 2:143060986-143061008 TCAGAGCTTAAAATAGTAGATGG - Intergenic
939681288 2:145136996-145137018 TGAGATCTTGAAACAGGAAAAGG + Intergenic
939746434 2:145976060-145976082 TAACATCTTAAAATACAAGATGG - Intergenic
939850893 2:147303153-147303175 TGAAAACTTAATAGAGGAGAAGG - Intergenic
939886196 2:147684651-147684673 TAAAAGCTTAAGACAGGAGATGG - Intergenic
939951908 2:148485430-148485452 TAAAATCTAAAAATAGATGAAGG + Intronic
940263687 2:151813879-151813901 TGAAATTATAAACTATGAGATGG + Intronic
940331143 2:152476075-152476097 TGTATTCATAAAAGAGGAGAAGG - Intronic
940350089 2:152674974-152674996 AGAACACTTAAAATAGGGGATGG + Intronic
940498263 2:154461590-154461612 TGTAATCTTCAAATAGAATAAGG + Intergenic
940560104 2:155283893-155283915 TCAAATTTTAAAAAATGAGAGGG + Intergenic
940611735 2:156001377-156001399 TGAGATTATAAAATAGGAAAAGG + Intergenic
940866403 2:158821925-158821947 TGAAATCTTTAAAGAGGAGCAGG - Intronic
940950542 2:159667714-159667736 TCAAATCTTAAAATAGGCCTGGG - Intergenic
942070638 2:172312536-172312558 TGAAATGTTATAATATGAGCAGG + Intergenic
942690115 2:178576111-178576133 TGAAATCGTAGAACGGGAGATGG - Exonic
942770178 2:179507800-179507822 TGAAATTTTAAAATTGGCTAAGG + Intronic
943035087 2:182734146-182734168 TTAAATCATAAAAAAGTAGAGGG - Intronic
943593469 2:189827502-189827524 TGAAATCATAAAATAATAAAAGG + Intronic
943820003 2:192309640-192309662 TGGAATTTTAAAACAAGAGATGG + Intergenic
943971971 2:194421802-194421824 TGGAATCCTAAAATAGAACAAGG + Intergenic
944190281 2:196995833-196995855 TGACGTCTTGAAATAGGAGGTGG - Intronic
945721875 2:213428220-213428242 TGAAGTCCCAATATAGGAGAGGG + Intronic
945960763 2:216132483-216132505 TGAATTCTTGCAATAGGAGTGGG + Intronic
947050841 2:226041002-226041024 ATAAATATTAAAATAGAAGATGG + Intergenic
947089938 2:226498344-226498366 TGGAATCATACAATAGGAAAAGG + Intergenic
947296051 2:228631799-228631821 TGAGAAGTTAAAATAGGAAAAGG + Intergenic
947654272 2:231812940-231812962 AGAAATGTTAAAATAGGTCAAGG - Intergenic
948156446 2:235787159-235787181 TCAACTCTTACAACAGGAGAGGG - Intronic
1168884641 20:1239648-1239670 TGAATTATTAAAATAGTATATGG + Intronic
1170131333 20:13023115-13023137 TGAAGACTTCAAGTAGGAGAAGG - Intronic
1171044017 20:21793626-21793648 TGAAGTCTTAAAATAGTGGAGGG - Intergenic
1171324559 20:24279959-24279981 TGAAATCTTAAAATTGGGCCTGG - Intergenic
1173506309 20:43589961-43589983 GGAAATTTTAAAAGTGGAGACGG - Intergenic
1175045217 20:56098715-56098737 TGAAATCCTAAAGTTGGAGGGGG + Intergenic
1176371232 21:6062376-6062398 TAAAATATTAAAATAAGAAAAGG - Intergenic
1176946684 21:14990611-14990633 TGAAATCTTAAAAGAGATGCTGG + Intronic
1178001992 21:28171683-28171705 TCACATTTTCAAATAGGAGAAGG - Intergenic
1179159470 21:38880983-38881005 TTAAATCCAAAAATAGGAAAAGG - Intergenic
1179752287 21:43476165-43476187 TAAAATATTAAAATAAGAAAAGG + Intergenic
1181939901 22:26467393-26467415 TGAATGCTTAAAGTAGGAGGTGG - Intronic
1182200388 22:28562564-28562586 GGAAGTCAAAAAATAGGAGAAGG - Intronic
1185263911 22:49887620-49887642 TGAAATCTGTAAATAGGAGGTGG + Exonic
949662828 3:6300982-6301004 CAAAATCTTAACCTAGGAGAAGG - Intergenic
949862153 3:8515668-8515690 TGGAATCGGGAAATAGGAGACGG + Intronic
950738910 3:15034045-15034067 TGAAATCTTGAGACAGGTGAGGG + Intronic
951162503 3:19441781-19441803 TTGAACCTTATAATAGGAGATGG + Intronic
952666263 3:35908253-35908275 TGAAATTTTTATATAGCAGATGG + Intergenic
952727926 3:36608015-36608037 TTAGAGCTTAAAATAGCAGAAGG - Intergenic
953092924 3:39747555-39747577 TGAGTTGTTAAAAGAGGAGAAGG + Intergenic
953871572 3:46631376-46631398 TGGAATCTCAATATGGGAGAGGG - Intergenic
954986376 3:54797371-54797393 TGAAATTGTACAATAGGAGGTGG - Intronic
956649216 3:71488265-71488287 TTTAATCTTAAAATAGGAGTTGG + Intronic
957197960 3:77094863-77094885 TCAAATTTTAAAATAGGCAAAGG - Intronic
958511646 3:95057458-95057480 AGAAATCTTAAAATATTAAAGGG - Intergenic
958531065 3:95330580-95330602 AGAAATATAAAAGTAGGAGAAGG - Intergenic
959540257 3:107529293-107529315 TGAAATGTTAAACAATGAGATGG - Intronic
960272627 3:115691063-115691085 GCAAATCTTAAAATTGAAGATGG + Intronic
960294395 3:115925254-115925276 TCAAATGTAAAAAGAGGAGAGGG + Intronic
960826828 3:121795803-121795825 TGAAATCTTTGAAAAGGAAATGG - Intronic
960931553 3:122856032-122856054 GGAACTCTTAAAATAAGAAAAGG - Intronic
961063681 3:123855681-123855703 TAAAATTTTTAAAAAGGAGAAGG + Intronic
961421367 3:126807347-126807369 TGAATTCATAAAATAAGAGTAGG + Intronic
961997187 3:131258334-131258356 TAAAAACTTAAAAAAAGAGAAGG + Intronic
964128491 3:153261887-153261909 TTAAAACTTAAAATATGAGTTGG - Intergenic
965017429 3:163175205-163175227 TGTAATAATAAAACAGGAGAAGG + Intergenic
965110421 3:164414171-164414193 TGAAATTTTAAAAAAGCAAAGGG - Intergenic
965160866 3:165131242-165131264 AGAAATCTTAAAATATGCCATGG - Intergenic
965386550 3:168053301-168053323 TGACATCTTAAACCAAGAGAGGG + Intronic
965873986 3:173295036-173295058 TGAAAACTTAAAATGGGGAAAGG - Intergenic
966447718 3:180021953-180021975 TTAACTCTTAAAATAGAAGATGG + Intronic
966551392 3:181208401-181208423 TGAACTTTTAAAAAAAGAGATGG - Intergenic
967390510 3:188949614-188949636 TGACATCTAAATAGAGGAGATGG - Intronic
967457664 3:189707168-189707190 TGAAGTGATAAAATAGTAGATGG - Intronic
967709942 3:192695349-192695371 TGAAGTCTTAATCTAGGAGGTGG - Intronic
969784717 4:9446620-9446642 TGAAATCCAAACTTAGGAGAAGG - Intronic
970425780 4:15945033-15945055 TGAAAGCTGAAAAAGGGAGAAGG + Intergenic
970681527 4:18514113-18514135 TGAAACCTTAACAAAGGTGAGGG - Intergenic
970712704 4:18882242-18882264 ATAAAACTTAAAATAGGAGACGG + Intergenic
970837311 4:20425795-20425817 TGAAAACTTAAAGTAGTAAATGG + Intronic
971348107 4:25830304-25830326 TGAAATCTTAAAATATGCACAGG - Intronic
971404699 4:26311661-26311683 TGAAATATTTAAATAGTAAAAGG - Intronic
972187439 4:36547799-36547821 TGAATTCTCAAAATAGGACAAGG - Intergenic
972324534 4:38002871-38002893 TGAAATGTTAAGAAAGCAGATGG + Intronic
973159524 4:46998426-46998448 TGAAGTTTTAAAATAGGTGGAGG + Intronic
973173009 4:47168513-47168535 TCAAGTCTTAATATAGGAGATGG - Intronic
974448175 4:62013972-62013994 TCAAATCATTAAAGAGGAGAGGG + Intronic
974549587 4:63353847-63353869 TTATATTTTAAGATAGGAGAGGG - Intergenic
974558787 4:63489765-63489787 TGAAAGCCTAAGATTGGAGACGG + Intergenic
974615826 4:64280243-64280265 TGAAATGTTATATTAGGAAAAGG + Intronic
975358042 4:73431130-73431152 TTAATTCTTAAGAAAGGAGAGGG - Intronic
976213755 4:82696114-82696136 TGAAATATTCAAATGGAAGAAGG + Intronic
976889664 4:90031396-90031418 TCAAATCTTAGAATAGTAGAGGG - Intergenic
977094733 4:92726173-92726195 TTAAAATTTAAGATAGGAGAGGG + Intronic
977162596 4:93653917-93653939 TGAAATGTTCAAATATTAGAAGG + Intronic
978189953 4:105899098-105899120 TCAAAAATTAAAATAGCAGAGGG - Intronic
978361809 4:107938860-107938882 TGATATATTAAATAAGGAGAGGG + Intronic
978421054 4:108533282-108533304 TCAATTCTGAAAATAGGATAGGG - Intergenic
978585817 4:110274653-110274675 CAAAATCTTAAAATAGGGTATGG - Intergenic
978718619 4:111876923-111876945 TGATATCTTCAAATTGGCGATGG - Intergenic
978813610 4:112878262-112878284 AGAAAGCTTCAAGTAGGAGATGG - Intronic
978962039 4:114692022-114692044 TGAAATATCAAAATAGGAGAGGG - Intergenic
979312771 4:119223532-119223554 TGAAAAGTCAAAAAAGGAGAAGG + Intronic
980005759 4:127540694-127540716 TAAAATCTTAAGAAGGGAGAGGG + Intergenic
980704191 4:136471793-136471815 TAATATCTTAAAATAGCAAAAGG - Intergenic
981136523 4:141216863-141216885 AGAAATCTTAAAATAGAGGCAGG - Intergenic
981352213 4:143744509-143744531 TGAAATTTAAAAGAAGGAGAAGG - Intergenic
981392919 4:144213368-144213390 TGCAACCTTAAAATATGAAAGGG + Intergenic
983036344 4:162871686-162871708 TGATATTTTAAAAGAAGAGAAGG - Intergenic
983795010 4:171851215-171851237 AGACAGCTTAAAATATGAGATGG - Intronic
986619859 5:9660763-9660785 TGAGTTCTTAAAATAGGAAGGGG + Intronic
987878029 5:23706290-23706312 GAAAAAATTAAAATAGGAGATGG - Intergenic
988024054 5:25661275-25661297 TGAAGACATAAAATAGGATATGG - Intergenic
988080338 5:26406521-26406543 TGACATCATCAAACAGGAGATGG - Intergenic
989154181 5:38328404-38328426 AGGAATCTTAAAAGAAGAGAAGG - Intronic
989509731 5:42271503-42271525 TCAGATCTTAAAATAGGAAGAGG + Intergenic
989531166 5:42509768-42509790 TGGATTCCTAAAATAGGAGCAGG - Intronic
989600668 5:43197663-43197685 GGAAATGGTAAAATGGGAGAGGG - Intronic
990435056 5:55781790-55781812 TTAAATCTAAAATTAAGAGATGG + Intronic
990763639 5:59158497-59158519 TGAAAACTCAAAATAGCAAATGG + Intronic
991205122 5:64041322-64041344 AGAAACCTCAAGATAGGAGATGG + Intergenic
992414051 5:76535956-76535978 TGAAAACATAAACTAGGAGAAGG + Intronic
993434570 5:87875922-87875944 TTAAGTGATAAAATAGGAGAGGG - Intergenic
994594432 5:101813278-101813300 TGAAAACTTAAAATAGAGTATGG + Intergenic
994804009 5:104419911-104419933 TTAAATATTAACATAGGATAAGG - Intergenic
995562423 5:113396897-113396919 TGAAATTTTACAAAAGAAGAAGG + Intronic
997138817 5:131356230-131356252 TGAAATCTTTAGATAACAGAAGG - Intronic
997581637 5:135020866-135020888 TGGAAACTTAAAAAAGGATAGGG + Intergenic
998012430 5:138705929-138705951 TGAAAGGTTAAGATATGAGAAGG - Intronic
998276191 5:140755323-140755345 CTAAATCTAAAATTAGGAGAAGG - Intergenic
998661422 5:144243004-144243026 TGGAATCTTGAAACAGGAAAAGG - Intronic
998715407 5:144878313-144878335 TGAAATATGAAAATTGGAGCAGG - Intergenic
998867214 5:146517465-146517487 TGAAATTTTAAAATAAGCAATGG + Intergenic
998946564 5:147346260-147346282 TGAAATATTATAAATGGAGATGG - Intronic
1000060014 5:157646482-157646504 TGAGAACATTAAATAGGAGAAGG - Intronic
1001180395 5:169514653-169514675 TGGAGTCTTAAAGCAGGAGAGGG + Intergenic
1002487562 5:179550261-179550283 TGAAAATTTAAAAGAGGAAATGG + Intergenic
1003480023 6:6522698-6522720 TTAATTCTTAAAATAAAAGAAGG + Intergenic
1003704121 6:8505431-8505453 TAAAAGCTTAAAAGAAGAGATGG + Intergenic
1003821501 6:9902686-9902708 TCAAAGCATATAATAGGAGAGGG - Intronic
1003911991 6:10751374-10751396 CAAAGTTTTAAAATAGGAGAAGG + Intronic
1004444250 6:15683598-15683620 TGAAAGCTTAAAAGAGGAAGTGG + Intergenic
1005075902 6:21907161-21907183 TGAAAACTTAAAATTGGAGCAGG - Intergenic
1005189621 6:23205424-23205446 TGATTCCTTAAAATAGCAGAAGG - Intergenic
1006669235 6:35719370-35719392 TGAAATCTTGATCTAGGTGATGG + Intronic
1006925316 6:37650742-37650764 TGAAGTCTTTAAATAGGCCAGGG - Intronic
1008316058 6:50042609-50042631 TCAACTCTAAAAATAGGTGATGG - Intergenic
1008381324 6:50842242-50842264 AGAAATTTTAATATAGGAGCTGG - Intronic
1008466604 6:51838194-51838216 TGAAATCTTAAATTATCAGTTGG - Intronic
1008880529 6:56376720-56376742 TGAAGTGTTGAAATAGGATAGGG + Intronic
1009268494 6:61588345-61588367 TGCAACCTCAAAAGAGGAGAAGG - Intergenic
1009341471 6:62559772-62559794 TGAAATAGGAAAATAGGAGGTGG + Intergenic
1010052268 6:71520063-71520085 GGATATATTAAAAGAGGAGAAGG - Intergenic
1010497255 6:76549920-76549942 TGAAAGTTTAAAAAAGGAGCTGG - Intergenic
1010801972 6:80186797-80186819 TGAAATATCAAAGTAGAAGAAGG - Intronic
1010879138 6:81146509-81146531 TGCATTATTAAAATAGCAGAAGG + Intergenic
1010954944 6:82079584-82079606 TTCATTGTTAAAATAGGAGAAGG - Intergenic
1011265682 6:85515738-85515760 TGAAAATTTAAAAGAGTAGAGGG - Intronic
1012059156 6:94455559-94455581 TAAAATCTTAAAGTAACAGAAGG + Intergenic
1012645195 6:101670295-101670317 TCAAATTTTTAAGTAGGAGACGG + Intronic
1014312249 6:119818685-119818707 TCAAATAGTAAAATAAGAGATGG - Intergenic
1014599739 6:123395798-123395820 TTAAAGCTTAAAATCAGAGAAGG - Intronic
1014633384 6:123814770-123814792 TGAAATATTAAATTAAAAGATGG - Intronic
1014650833 6:124035157-124035179 AGGAATCCTAAAATGGGAGAAGG + Intronic
1015065990 6:129028810-129028832 TGAAATATTAAAATAATAAAGGG - Intronic
1015806350 6:137113188-137113210 TTAAATTTAAAAAAAGGAGATGG - Intergenic
1018280960 6:162184950-162184972 TGTAATCTTAAAATAAGGGTGGG + Intronic
1018425429 6:163675912-163675934 TGATATTTAATAATAGGAGATGG + Intergenic
1018544060 6:164916111-164916133 TGAATTCTAACTATAGGAGAGGG + Intergenic
1018555628 6:165047756-165047778 TGAAATGGTGAAATAGTAGATGG + Intergenic
1018989847 6:168665824-168665846 TGAAATAATAAAACAGAAGAAGG + Intronic
1021125161 7:16843678-16843700 TGAACTCTGAAAATTGGATACGG - Intergenic
1021153064 7:17176017-17176039 TCAAATTTTCAACTAGGAGACGG - Intergenic
1021362069 7:19727857-19727879 TGAAATTTGAAAATAGTATATGG - Intronic
1021479482 7:21100334-21100356 TGAAAAATTCAAATAGGAGAGGG - Intergenic
1021541239 7:21760967-21760989 TGAAAGCTTAATATAGCAAAGGG - Intronic
1021819825 7:24485703-24485725 TCATATCCTAAAATAGAAGATGG - Intergenic
1022257838 7:28677092-28677114 TTTTATCTTAAAATAGAAGAGGG + Intronic
1023525721 7:41100738-41100760 TGAAATCTAAATATAGAAAATGG - Intergenic
1023652102 7:42382204-42382226 TGAAATGTGAACAAAGGAGATGG - Intergenic
1024161990 7:46685581-46685603 TTAAATTTTAAAATAGTAGAAGG - Intronic
1027767277 7:82361013-82361035 TGAAGCCTTCAAATATGAGATGG + Intronic
1027816805 7:82984246-82984268 TGGAATCTTAATATTTGAGAAGG - Intronic
1027831798 7:83186177-83186199 TGGAATCCTGAAATAGGAAAAGG + Intergenic
1029160352 7:98547360-98547382 TGAAATCTTCAATTTGGAAAAGG + Intergenic
1030907857 7:115208783-115208805 TGAAATCTTAAGAGAGATGAAGG + Intergenic
1030938776 7:115618673-115618695 TGAAATCCTGAAACAGGTGATGG - Intergenic
1031286839 7:119881203-119881225 TCAAAGCTTAAAATGGGAAATGG + Intergenic
1031333918 7:120502281-120502303 TGAAAGCTTAGCATAGGGGAAGG - Intronic
1032619894 7:133518352-133518374 TGAAAAAAAAAAATAGGAGAGGG - Intronic
1032787752 7:135213975-135213997 TGAGATCTCAAAGTAGGAGTTGG - Intergenic
1033295668 7:140132096-140132118 CTAAGTCTTAAAATAGGGGAGGG + Intronic
1033440866 7:141377441-141377463 TGATTTCTTAAAATAGAAGCAGG - Intronic
1033958753 7:146885984-146886006 TGAAATCTTAAAAATGTAAAGGG - Intronic
1034853367 7:154516925-154516947 TGAAATCAGAAAATTCGAGATGG - Intronic
1034913866 7:155020937-155020959 TGAAAACTTAGAAAGGGAGAAGG - Intergenic
1035012469 7:155731703-155731725 TGAAATCTGAAAATATTAAATGG - Intronic
1036834319 8:12047513-12047535 TGAAATCCAAACTTAGGAGAAGG + Intergenic
1036856164 8:12294077-12294099 TGAAATCCAAACTTAGGAGAAGG + Intergenic
1039004832 8:33023199-33023221 TGATTTCTTAACTTAGGAGAGGG + Intergenic
1039180626 8:34862007-34862029 TGAAAAATTAAAATATTAGACGG + Intergenic
1040579332 8:48683504-48683526 TTATGTCTTAAAATTGGAGAAGG - Intergenic
1040957384 8:52993689-52993711 TTTAATCTTAAAATATGACATGG + Intergenic
1041342020 8:56856187-56856209 TGAGTTTTTAAAATTGGAGAAGG - Intergenic
1042382435 8:68133079-68133101 AGAAAACTTAGAATGGGAGAAGG + Intronic
1042460275 8:69057769-69057791 TGGAATCCTAAAATATAAGAGGG - Intergenic
1042525839 8:69763761-69763783 TAAAATTTTAAGATAGGATATGG + Intronic
1042826786 8:72987552-72987574 TGTAATCTTAAAGTAGGTGAGGG + Intergenic
1043852476 8:85230394-85230416 TGAAATGTAAAAATAGGCAAGGG + Intronic
1043998636 8:86850285-86850307 TGAAAACATAAAAGAAGAGAGGG + Intergenic
1044725737 8:95192890-95192912 TTATGTCTTAAAAAAGGAGAGGG - Intergenic
1045378307 8:101598164-101598186 TAAAGTCATAAAATAAGAGAAGG + Intronic
1045727729 8:105195402-105195424 TGAAATCTTGAACTTGAAGAAGG - Intronic
1045761250 8:105610416-105610438 TGAAAAGTTAAAATAGAAGAAGG + Intronic
1045864993 8:106854719-106854741 TAAAATTTTAAGATAAGAGATGG + Intergenic
1045986720 8:108257607-108257629 CCAAATCTTAAAATATGACAAGG - Intronic
1046737266 8:117790421-117790443 TGACATCTTAAAAAATGAGTAGG - Intergenic
1047517357 8:125566770-125566792 TGATAGCTTGGAATAGGAGATGG + Intergenic
1047688993 8:127331378-127331400 ACAAAAATTAAAATAGGAGATGG + Intergenic
1047751939 8:127888392-127888414 AGACTTCTTAAAACAGGAGATGG + Intergenic
1047869084 8:129062398-129062420 TAAAATATTTAAACAGGAGAAGG + Intergenic
1048048716 8:130797070-130797092 TACAATTTTAAAATATGAGAGGG + Intronic
1048193779 8:132314819-132314841 AGAAGTCTTAAAATATGAGCAGG + Intronic
1048513767 8:135086379-135086401 TGAAATCTTGAAATACTAGGGGG - Intergenic
1048734987 8:137488960-137488982 TGGTAACTTAAAAAAGGAGATGG + Intergenic
1050237088 9:3593500-3593522 TGAAAAATGAAACTAGGAGATGG - Intergenic
1051070709 9:13162567-13162589 TAAAATCTTGAAAGAGGAAAAGG + Intronic
1052348801 9:27437077-27437099 GGAAATCCTGAAAGAGGAGATGG + Intronic
1052740756 9:32390491-32390513 TGCAGTCTTCAAATAAGAGAAGG + Intronic
1053335344 9:37265218-37265240 TGAAAGCATGAAAAAGGAGAAGG - Intronic
1055179702 9:73369978-73370000 TGAAATATAAAGATGGGAGAAGG - Intergenic
1056089783 9:83194187-83194209 TGGAATCCTAAAACAGGAAAAGG - Intergenic
1056651645 9:88470097-88470119 TGAAATCTCAAAATATGCTAAGG - Intronic
1058471934 9:105288642-105288664 CGAAATATTAAAATAGGACCAGG - Intronic
1059675988 9:116540134-116540156 TGAAATCTTAGGAATGGAGAAGG - Intronic
1060359633 9:122942378-122942400 TGAAAACTGAAAATAGGGGCCGG + Intronic
1061140861 9:128765656-128765678 TGAAATATTAACCTAGGAGCTGG + Intronic
1061634001 9:131894291-131894313 GAAAATCTTAAAATGGGAAAGGG - Intronic
1185828761 X:3278124-3278146 TGAAAACTAAAAATAGTAAAGGG + Intronic
1186058735 X:5680705-5680727 TGAAATCAAACAGTAGGAGATGG + Intergenic
1186151861 X:6683144-6683166 TGTAATCCTAATATTGGAGAAGG - Intergenic
1186198768 X:7135734-7135756 TGAAAAGTTAAAATAGGAAAGGG - Intronic
1187647568 X:21365177-21365199 TGAAATTTAAAAAAAGAAGATGG - Intergenic
1187967256 X:24624349-24624371 TCAAATGTAAAAATAGGAAAGGG - Intronic
1188968800 X:36587469-36587491 TGAAATTTTAAAGCAGGAGATGG - Intergenic
1189098629 X:38165722-38165744 TAATATCTTAAAATAGGCAATGG + Intronic
1190737583 X:53266092-53266114 TGACATCTATAAAAAGGAGAAGG - Intronic
1191057834 X:56261347-56261369 TAAAGTCTTAAAATAGCAAATGG + Intronic
1191678046 X:63811993-63812015 TAAAATTTTAAAAAAGGAGTAGG + Intergenic
1194815736 X:98439498-98439520 TGAAATTTGACAACAGGAGAAGG - Intergenic
1195048790 X:101078702-101078724 TCAAATCTTAAATGGGGAGAAGG - Exonic
1195560306 X:106275658-106275680 TGAAATCATAAACTAGGAGTTGG + Intergenic
1195561656 X:106290681-106290703 TGAAATCATAAACTAGGAGTTGG - Intergenic
1196504345 X:116423879-116423901 GGATATCTCAAAATAGGTGAGGG - Intergenic
1198137858 X:133772052-133772074 TGAAAACTAAATACAGGAGAAGG - Intronic
1199057481 X:143315379-143315401 TGCATTCATAAAATAGGAGTAGG - Intergenic
1199285269 X:146047801-146047823 TGAAAAATTAAAGTTGGAGAGGG - Intergenic
1199824869 X:151488923-151488945 TGACTGCTTAAAATGGGAGATGG - Intergenic