ID: 1090641430

View in Genome Browser
Species Human (GRCh38)
Location 11:128732256-128732278
Sequence CTTCTCATCTAGGACATCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 125}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090641422_1090641430 5 Left 1090641422 11:128732228-128732250 CCAGATTATTCTCCAGCTATCTT 0: 1
1: 0
2: 0
3: 15
4: 167
Right 1090641430 11:128732256-128732278 CTTCTCATCTAGGACATCTAAGG 0: 1
1: 0
2: 0
3: 12
4: 125
1090641423_1090641430 -7 Left 1090641423 11:128732240-128732262 CCAGCTATCTTCCCCCCTTCTCA 0: 1
1: 0
2: 0
3: 35
4: 375
Right 1090641430 11:128732256-128732278 CTTCTCATCTAGGACATCTAAGG 0: 1
1: 0
2: 0
3: 12
4: 125
1090641421_1090641430 15 Left 1090641421 11:128732218-128732240 CCAATCAGTACCAGATTATTCTC 0: 1
1: 0
2: 1
3: 9
4: 86
Right 1090641430 11:128732256-128732278 CTTCTCATCTAGGACATCTAAGG 0: 1
1: 0
2: 0
3: 12
4: 125
1090641420_1090641430 23 Left 1090641420 11:128732210-128732232 CCATTCAGCCAATCAGTACCAGA 0: 1
1: 1
2: 0
3: 9
4: 158
Right 1090641430 11:128732256-128732278 CTTCTCATCTAGGACATCTAAGG 0: 1
1: 0
2: 0
3: 12
4: 125
1090641419_1090641430 27 Left 1090641419 11:128732206-128732228 CCATCCATTCAGCCAATCAGTAC 0: 1
1: 0
2: 0
3: 16
4: 213
Right 1090641430 11:128732256-128732278 CTTCTCATCTAGGACATCTAAGG 0: 1
1: 0
2: 0
3: 12
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090641430 Original CRISPR CTTCTCATCTAGGACATCTA AGG Intronic
901867320 1:12115571-12115593 CTTCTCCACAAGGTCATCTAAGG - Exonic
906442078 1:45856366-45856388 CTTCTCATATAAGAAGTCTAGGG + Intronic
909901979 1:81149173-81149195 CTTCTCCTCTGAGCCATCTACGG - Intergenic
912246221 1:107964658-107964680 CTCCTCACCTGGGACATCTGCGG + Exonic
915054343 1:153112418-153112440 CTTCTCATCAAAGCCATCCAGGG - Exonic
915056771 1:153140394-153140416 CTTCTCATCAAAGCCATCCAGGG - Intergenic
915150285 1:153825358-153825380 CTCCTCTTCCAGGACCTCTAGGG + Intronic
920296243 1:204958883-204958905 CTTCTCATTCAGGACAGGTAGGG + Intronic
920332027 1:205216283-205216305 CTTCTGATTTAGTAAATCTAGGG + Intergenic
922252188 1:223859588-223859610 CTTTTCATCCAGGACTTCTGAGG - Intergenic
922317982 1:224459131-224459153 TTTATCTTCTAGGACATCCAGGG + Intronic
1067778473 10:49179722-49179744 ATTCCCATCTGGGACATCTGAGG - Intronic
1068797468 10:61099584-61099606 CTGAACATCTAGGATATCTATGG + Intergenic
1069237035 10:66089182-66089204 CTTTTTATCTAGTACATATAGGG + Intronic
1072146587 10:92645351-92645373 CTTTTCCTATAGGAAATCTAAGG + Exonic
1073561595 10:104501800-104501822 ATTCTCATCTAGCAACTCTAAGG - Intergenic
1076194844 10:128510435-128510457 CTTCTCTTCAAAGACATCTGCGG - Intergenic
1077419072 11:2441157-2441179 CTTTGCATCTAGGACAGCCAGGG + Intergenic
1080699373 11:34631532-34631554 AATCACATCTAGGACATCTCAGG + Intronic
1082101454 11:48176503-48176525 CTTCCCATCTAGGGAGTCTATGG - Intergenic
1086502445 11:87467189-87467211 CTTCTGACCTAGCACATCTAGGG + Intergenic
1090641430 11:128732256-128732278 CTTCTCATCTAGGACATCTAAGG + Intronic
1091578045 12:1757696-1757718 CGTCTCATCTATGACACCAAGGG - Intronic
1092999487 12:13981566-13981588 CTTCACCTCTAGGAAATCTCGGG - Intergenic
1098031518 12:66259382-66259404 CTTTTCATCTAGCATATTTAAGG - Intergenic
1099293008 12:80795357-80795379 CATCACACCTAGGACATCTAAGG - Exonic
1100030653 12:90186237-90186259 CTTCTCCTGCAGGTCATCTAAGG + Intergenic
1100286341 12:93170253-93170275 CTTCACCTCTAGGGAATCTATGG + Intergenic
1107585490 13:41842918-41842940 CTGCTCTTCTAGGGCATCAATGG + Intronic
1107674877 13:42784946-42784968 CTTCTCATTTAGGAAGTTTAGGG + Intronic
1109394955 13:61744768-61744790 CTTGTCTTCTAGGTCTTCTATGG - Intergenic
1115776604 14:36722107-36722129 CATCTCAACTAGGACATTTCAGG - Intronic
1116592616 14:46798345-46798367 TTTCTCATCAAAGACATCTCAGG - Intergenic
1116658950 14:47683147-47683169 ATTCTTCTCTAGGACATCTCGGG - Intergenic
1120545779 14:85809458-85809480 CTTCTATTCAGGGACATCTATGG + Intergenic
1121916331 14:97839606-97839628 CTTCTCATCTAGGAAAAGAAAGG + Intergenic
1125021502 15:34991106-34991128 CTTCTCATTAAGGCCATCTCTGG - Intergenic
1125198326 15:37074231-37074253 ATTCAGATATAGGACATCTAAGG - Intronic
1130918720 15:88326153-88326175 CTTCTTCTCTAGGACTTCCATGG - Intergenic
1131139994 15:89969476-89969498 GTTCTTATCTAGGAGATTTATGG - Intergenic
1133562148 16:6960276-6960298 CTTCTCATCTATAAGATCTGAGG - Intronic
1133683687 16:8145721-8145743 ATTTTCATCTAGGACATCATAGG - Intergenic
1134468715 16:14502354-14502376 TTTCTCCTCTAGGACATCAGAGG + Intronic
1134855788 16:17517832-17517854 ATTCTGATCTAGTAGATCTAGGG + Intergenic
1137069629 16:35891594-35891616 CTTCTCATTTAGGATTACTATGG - Intergenic
1139332205 16:66202053-66202075 CTTCTCTTCTATGATGTCTAGGG - Intergenic
1143872651 17:9968386-9968408 ATTCTAATCCAGGAGATCTAGGG - Intronic
1143926232 17:10373383-10373405 CTTCTCATCTCAGAAATCTCTGG + Intergenic
1144293450 17:13849867-13849889 TTTCTCATCAATGACATCTGAGG + Intergenic
1146838462 17:36132218-36132240 CATCTGATCTAGTACATTTATGG + Intergenic
1147000281 17:37357807-37357829 CTTCTCATCACAGACATCCAGGG + Intronic
1150991720 17:70267443-70267465 CCTCTCATCAAGAACATCTCTGG + Intergenic
1151247162 17:72803786-72803808 CTTCTCTTCAAGGCCATCCAGGG - Intronic
1151294465 17:73174346-73174368 CTCCTCATCTAGGGCAGCTGGGG - Intergenic
1152006759 17:77687211-77687233 CTTTTCATCTGGGCCTTCTAAGG - Intergenic
1153422398 18:4922029-4922051 ATTCTCTTCTAGGAGATTTATGG + Intergenic
1154132691 18:11750640-11750662 ACTCTCATCAAGGTCATCTAGGG - Intronic
1157061000 18:44290363-44290385 TTTCTCATCTAGAACTTCTCTGG + Intergenic
1157463358 18:47922270-47922292 TGCCTCATCTAGAACATCTAAGG + Intronic
1158466822 18:57698080-57698102 CTTTTCATCTAGGTCATGTAAGG + Intronic
1160349867 18:78168306-78168328 CTTTTCTTCTAGGAAAACTAAGG - Intergenic
1164791719 19:30991257-30991279 CTTCTCTTCTGTGACCTCTAGGG + Intergenic
1167775390 19:51551284-51551306 GTTATCTTCTGGGACATCTAGGG + Intergenic
926474240 2:13302673-13302695 CATCTTACCTAGGACATCTTGGG - Intergenic
927278573 2:21283103-21283125 CTTCTCATTTCAGATATCTATGG - Intergenic
927404528 2:22752031-22752053 GTTTTCATCTAAGTCATCTATGG + Intergenic
928535777 2:32239932-32239954 ATTCTCACGTAGGACATATAAGG + Intronic
933352631 2:81174603-81174625 CTTTTCAGATAGGACATCAATGG - Intergenic
935177673 2:100663969-100663991 CATCGCTTCTAGGACATCTGAGG - Intergenic
939846689 2:147255205-147255227 CTTGTTACGTAGGACATCTAGGG + Intergenic
946073401 2:217053624-217053646 CTTCTCTTCTAGGGCCTGTATGG - Intergenic
1174296384 20:49548241-49548263 CTTCTCAGCTATGAGATCTTGGG - Intronic
1177070158 21:16494835-16494857 CTTCTGATTTAAGACATCCACGG + Intergenic
1177225198 21:18244940-18244962 CTTCGCCTCTAGGACATACACGG + Exonic
1177272632 21:18869585-18869607 CTTCTCATGTAGGATATTTCAGG + Intergenic
1177957752 21:27621819-27621841 CTTTTCATCTATTACATATAGGG - Intergenic
1184885237 22:47340951-47340973 CTTCTCATCTAGGAATTATGAGG + Intergenic
952478462 3:33735111-33735133 CTTCTCAGCTATGACACATAGGG + Intergenic
954301890 3:49704707-49704729 ATCCTCATCTAGGTCATCCATGG - Exonic
954372734 3:50177157-50177179 CTTCTCTTCTAGGAAGCCTATGG - Intronic
963937574 3:151070277-151070299 CTTCTCATATAGGACAAAAAAGG + Intergenic
964186978 3:153957648-153957670 CTTCTCATTTTGTGCATCTACGG - Intergenic
964187099 3:153959189-153959211 CTTCTCATTTAGTGCATCTATGG - Intergenic
966206374 3:177410738-177410760 CCTCTCACCCAGGACAGCTAAGG + Intergenic
969185953 4:5474374-5474396 CTTCTCATCTGTGCCATCAAGGG + Intronic
970116647 4:12704422-12704444 CTTGTCTTCTAGGACATATAAGG - Intergenic
971503848 4:27345141-27345163 TTTCTCATTTAGGGCATCAAGGG - Intergenic
972157819 4:36186420-36186442 CTTTTCATCTATATCATCTATGG - Intronic
975393191 4:73844205-73844227 CTTCTCATCTTGGAAATCAAAGG + Intronic
977479824 4:97561552-97561574 GTTTTCTTCTAGGACTTCTATGG + Intronic
980486449 4:133463045-133463067 CTTCTCAACGAGGACATCTGTGG + Intergenic
981640678 4:146940361-146940383 CTTATCATCTATCACATCTAAGG - Intronic
983058839 4:163131195-163131217 CTTCTTAGATAGGACATCAAAGG + Intronic
984112417 4:175634789-175634811 CTTCTCATCAATGATATGTAAGG - Exonic
984725987 4:183021643-183021665 TTTCTCATCTGGGAGATCTCAGG - Intergenic
988015447 5:25552092-25552114 CTACTCATTTAGGAAATTTACGG + Intergenic
990823008 5:59864167-59864189 GGTTTCATCTAAGACATCTAAGG - Intronic
991486732 5:67144917-67144939 TTTCTCATCCAGTAGATCTAGGG + Intronic
996354453 5:122580488-122580510 CTTCAGATCTAAGACCTCTAAGG + Intergenic
999388056 5:151169420-151169442 CTGCTCATCTAGGTCATTTCAGG + Intergenic
1004388640 6:15190691-15190713 CCTCTCATCTCGGCCTTCTAAGG - Intergenic
1008463317 6:51801385-51801407 CTTATCTTCTAGCACATCTCTGG - Intronic
1008491009 6:52087292-52087314 CTTCTCCTTTGGGACATCGAGGG + Intronic
1010064977 6:71672024-71672046 CCTCTCCTCTAGGACATCAACGG - Intergenic
1010310537 6:74379329-74379351 CTTCTGATTGAGGAGATCTAGGG - Intergenic
1012795977 6:103761873-103761895 ATTCTCATCTGGGTAATCTAAGG + Intergenic
1013075361 6:106766021-106766043 ATCCTAATCTAGGATATCTAGGG + Intergenic
1016166770 6:140955236-140955258 CTTTTCATCTAGGAAATTTTTGG - Intergenic
1028344069 7:89758790-89758812 CTTCTCAGCTAGGCCTTATAGGG - Intergenic
1031377102 7:121040407-121040429 CTCTTCATGTAGGAGATCTATGG - Intronic
1032334728 7:131014788-131014810 CTTCACATCTAGTACAACTGAGG + Intergenic
1033071492 7:138207441-138207463 CTTCCAATCTAGGACAGCTTGGG + Intergenic
1036497528 8:9283002-9283024 CCTCTCTTCCAGGACAACTAAGG + Intergenic
1039335610 8:36585940-36585962 CATCTCCTCTAGAACATGTAGGG + Intergenic
1039432224 8:37533861-37533883 CGTCTCATCTCTGACATCAAAGG + Intergenic
1040451007 8:47547273-47547295 CGTCTCATCTATGACACCAAGGG - Intronic
1040898982 8:52397560-52397582 CTTCTCACCTAGGAGTTTTATGG + Intronic
1045015174 8:97995127-97995149 CCTGTCATCTAGCACATCAAAGG + Intronic
1045318246 8:101061685-101061707 CTTCTCAGCCAGGTCATCTTAGG - Intergenic
1046903612 8:119548507-119548529 CTACTCATCTATGCCATCTCTGG - Intergenic
1047145788 8:122197749-122197771 CTTCACCTCTAGGATATCTCAGG + Intergenic
1050251490 9:3749501-3749523 ATGCCCATCTAGGGCATCTATGG - Intergenic
1050766595 9:9142196-9142218 CTGCTCTTCTAGGGCTTCTATGG - Intronic
1051543305 9:18245580-18245602 CTTCTCAACTGGGACACCTAAGG - Intergenic
1051870344 9:21730151-21730173 TTTTTCATCTAGGACAACTGAGG + Intergenic
1055708153 9:79031247-79031269 ATTCTCATCCAGGAAATCTAAGG - Intergenic
1058927365 9:109680172-109680194 CTTCCCACCTAGGATATATATGG + Intronic
1061252626 9:129435688-129435710 CTTCCCAGCTAGGAGATCTTGGG + Intergenic
1191660424 X:63643837-63643859 CCTGTCATCAAGGACACCTAGGG + Intronic
1192054962 X:67764137-67764159 TTTCTCATCAATGAAATCTATGG - Intergenic
1193701057 X:84761699-84761721 CTTGGCATCTAGGACATCTTTGG - Intergenic
1193828412 X:86256354-86256376 ATTCTCATCTTGGACATCAGTGG - Intronic
1196053436 X:111329992-111330014 CTTCTGAACTTGGACTTCTAAGG + Intronic
1197768459 X:130074056-130074078 CTTCTCATCCAGGATATCGCTGG + Exonic
1198108373 X:133481935-133481957 CTACTCTCCTAGGACTTCTAAGG - Intergenic
1199426645 X:147709577-147709599 CTTCTGATTCAGGAGATCTAAGG - Intergenic
1199520531 X:148730304-148730326 CTCATCATCTAGGAAATCTTTGG - Intronic
1201675432 Y:16577326-16577348 CTTCTTCTGTAGGATATCTATGG + Intergenic