ID: 1090641637

View in Genome Browser
Species Human (GRCh38)
Location 11:128734335-128734357
Sequence CTGAGTACTCAGATGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 855
Summary {0: 1, 1: 0, 2: 3, 3: 72, 4: 779}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090641634_1090641637 11 Left 1090641634 11:128734301-128734323 CCTCATCTGATCTTGGAAGCTAA 0: 3
1: 1
2: 5
3: 15
4: 159
Right 1090641637 11:128734335-128734357 CTGAGTACTCAGATGGAAGAAGG 0: 1
1: 0
2: 3
3: 72
4: 779
1090641632_1090641637 30 Left 1090641632 11:128734282-128734304 CCACAGTGCTCTGAACGTGCCTC 0: 1
1: 0
2: 1
3: 21
4: 156
Right 1090641637 11:128734335-128734357 CTGAGTACTCAGATGGAAGAAGG 0: 1
1: 0
2: 3
3: 72
4: 779

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090641637 Original CRISPR CTGAGTACTCAGATGGAAGA AGG Intronic
901386006 1:8909698-8909720 GTGAGCACTCAGATGGACGTAGG - Intergenic
901451229 1:9338083-9338105 TTGAGTGCTCAGATGGGGGAGGG + Intronic
901726512 1:11247109-11247131 CTGAGGGCTATGATGGAAGAAGG + Intronic
901775951 1:11560568-11560590 CTGTGTGCTCAGATAGAAGTAGG - Intergenic
901840843 1:11952992-11953014 CTGTGTCCTCAGATGGTGGAAGG + Intronic
902154348 1:14472080-14472102 CTGCTTACTCACATGGCAGAAGG + Intergenic
902967172 1:20014050-20014072 CTGTGTCCTCACATGGCAGAAGG + Intergenic
904352854 1:29920271-29920293 CTGTGTCCTCACATGGCAGAAGG - Intergenic
905000453 1:34664045-34664067 CTGTGTCCTCACATGGCAGAAGG - Intergenic
905925675 1:41747937-41747959 GGCAGTAATCAGATGGAAGAAGG + Intronic
906173672 1:43749861-43749883 CTGTGTCCTCATATGGCAGAAGG - Intronic
906191555 1:43902480-43902502 GAGAGTTCTCAGATGGAAGAAGG - Intronic
906745663 1:48220698-48220720 CTGTGTCCTCACATGGCAGAAGG + Intergenic
906857099 1:49319761-49319783 CTGAGTCATCAAATGGCAGAAGG + Intronic
906935565 1:50211346-50211368 CTGTGTCCTCACATGGTAGAAGG + Intergenic
907078509 1:51599922-51599944 CTGTGTCCTCACCTGGAAGAAGG + Intronic
907091628 1:51730153-51730175 CTGAGAACTCCCAAGGAAGAGGG - Intronic
907964166 1:59313130-59313152 CTGTGTCCTCACATGGTAGAAGG + Intronic
908158930 1:61386947-61386969 CTGTGTCCTCACATGGCAGAAGG + Intronic
908499475 1:64728910-64728932 CTGTGTCCTCACATGGCAGAAGG - Intergenic
908719403 1:67108298-67108320 CTGTGTCCTCACATGGGAGAAGG + Intronic
908901103 1:68957540-68957562 CTGTGTCCTCACATGGCAGAAGG - Intergenic
909239389 1:73192840-73192862 CTGTGTCCTCACATGGAAGAAGG + Intergenic
909878833 1:80847465-80847487 CTGTGTACTCACATGGCAGAAGG + Intergenic
909904012 1:81174533-81174555 CTGAGTCCTCAGGTGTCAGAAGG + Intergenic
910253481 1:85222517-85222539 CTGTGTCCTCACATGGTAGATGG + Intergenic
910544641 1:88400110-88400132 CTGTGTCCTCACATGGTAGAAGG + Intergenic
910832144 1:91471671-91471693 CTGAGTCCTCACATGGAAAAAGG - Intergenic
911378033 1:97075628-97075650 CTGTGTCCTCACATGGTAGAGGG - Intergenic
911441175 1:97927490-97927512 CTGTGTCCTCAGATGGCAGAAGG + Intergenic
912453050 1:109779136-109779158 CTGTGTCCTCACATGGTAGAAGG + Intergenic
912667607 1:111596736-111596758 CTGTGTCCTCACATGGTAGAAGG + Intronic
912744865 1:112237747-112237769 CTGAGTAATCAGAGGGTAGGAGG - Intergenic
913050293 1:115111664-115111686 CTGTGTCCTCACATGGTAGAAGG - Intergenic
914077492 1:144369066-144369088 CTGTGTCCTCACATGGAGGAAGG + Intergenic
914101687 1:144597439-144597461 CTGTGTCCTCACATGGAGGAAGG - Intergenic
915663096 1:157419946-157419968 CTGTGTACTCACATAGCAGAAGG - Intergenic
915663147 1:157420250-157420272 CTGTGTCCTCACATGGTAGAAGG - Intergenic
915863388 1:159471778-159471800 CTGTGTCCTCAGTTGGCAGAAGG - Intergenic
916516061 1:165517768-165517790 CTGAGTACACACATAAAAGATGG + Intergenic
918072098 1:181140670-181140692 CAGTGTTCTCAGCTGGAAGATGG + Intergenic
918119643 1:181527255-181527277 CTGTGTCCTCACATGGTAGAAGG + Intronic
918507935 1:185278314-185278336 CTGTGTTCTCACATGGCAGAAGG - Intronic
918961136 1:191279682-191279704 CTGTGTTCTCACATGGCAGAAGG + Intergenic
919094314 1:193011385-193011407 CTGAGTACTCAGAACACAGATGG + Intergenic
919639752 1:200036417-200036439 GTGAGTGCTCAGAGGGAGGAGGG + Intronic
919743935 1:200996892-200996914 CTGTGTACTGAGATGGGAGAGGG - Intronic
920396133 1:205647506-205647528 CTGTGTCCTCACATGGCAGAAGG + Intergenic
920724986 1:208426668-208426690 CTGTGTCCTCACATGGAGGAAGG + Intergenic
920724990 1:208426708-208426730 CTGTGTCCTCACATGGTAGAAGG + Intergenic
920744211 1:208610765-208610787 CTGTGTCCTCATGTGGAAGAAGG + Intergenic
922419665 1:225451061-225451083 CTGAGTGAGCAGAAGGAAGAGGG - Intergenic
922438062 1:225625898-225625920 CAGAGTTCTAAAATGGAAGAAGG - Intronic
922514181 1:226194688-226194710 CTGAGTCCTCACATGGTAGAAGG + Intergenic
922527059 1:226312081-226312103 CTGTGTCCTCACATGGTAGAAGG + Intergenic
923068048 1:230538256-230538278 CTGTGTTCTCACATGGTAGAAGG + Intergenic
923079690 1:230641953-230641975 CTGGGAACTCATAGGGAAGAAGG - Intergenic
923263651 1:232291488-232291510 CTGAGAAGGAAGATGGAAGAAGG + Intergenic
923319529 1:232816939-232816961 CTGTGTCCTTACATGGAAGAAGG + Intergenic
923426842 1:233879068-233879090 ATGAGTGCTCAGATGGAGGTGGG + Intergenic
923676854 1:236087869-236087891 CTGTGTCCTCACATGGCAGAAGG + Intergenic
923764315 1:236878929-236878951 ATGAGAACTGAGCTGGAAGATGG - Intronic
924187594 1:241511227-241511249 CTGTGTCCTCACATGGTAGAAGG - Intronic
924494866 1:244577595-244577617 CTGTGTCCTCACATGGCAGAAGG + Intronic
1062949042 10:1482807-1482829 CCTAGAACACAGATGGAAGAAGG - Intronic
1063041132 10:2338374-2338396 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1063108171 10:3012007-3012029 CTGTGTCCTCACATGGTAGATGG - Intergenic
1063559131 10:7110215-7110237 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1063801068 10:9578855-9578877 CTGGGTTCTCACATGGTAGAAGG + Intergenic
1064001600 10:11668185-11668207 CTGCGTCCTCACCTGGAAGAAGG + Intergenic
1064706332 10:18076172-18076194 CTGTGAACTCAGAGGGGAGACGG - Intergenic
1065228826 10:23575562-23575584 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1065327466 10:24561481-24561503 CTGTGTCCTCACATGGTAGAGGG - Intergenic
1065460343 10:25956070-25956092 CTGTGTTCTCACATGGCAGAAGG + Intronic
1065525192 10:26613072-26613094 ATGAGCAATCTGATGGAAGAAGG + Intergenic
1065869003 10:29940170-29940192 CTGAGCCCTCACATGGTAGAAGG - Intergenic
1066020085 10:31289723-31289745 CTGTGTCCTCACATGGCAGATGG - Intergenic
1066174575 10:32890650-32890672 CTGTGTCCTCAGATGGTGGAAGG + Intergenic
1066196521 10:33105807-33105829 CTGAATACGCCTATGGAAGAAGG - Intergenic
1066262834 10:33745765-33745787 CTCAGGAAACAGATGGAAGAGGG + Intergenic
1066485021 10:35834961-35834983 CTGAATCCTCAGCTGGAAAAGGG + Intergenic
1066630024 10:37450138-37450160 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1067846452 10:49725927-49725949 CTGTGTCCTCACATGGCAGATGG - Intergenic
1068124499 10:52822347-52822369 CTGAGTTCAGAGAAGGAAGATGG + Intergenic
1068153121 10:53160021-53160043 CTGTGTCCTCACATGGTAGAAGG - Intergenic
1068174955 10:53446425-53446447 CTGAGTGCTCACATGGTGGAAGG + Intergenic
1068659658 10:59611115-59611137 CTGTGTCCTCAGATGGCAGGGGG - Intergenic
1068711661 10:60141518-60141540 CAGTGTACCCAGATGGAAGATGG - Intronic
1069036992 10:63656032-63656054 CTGAGTCCTCACATGGTGGAAGG - Intergenic
1069104281 10:64363843-64363865 TTGAGTACACAGAAGGAACAAGG + Intergenic
1069656366 10:70092163-70092185 CTGTGTCCTCACATGGCAGAAGG - Intronic
1069747549 10:70725559-70725581 CTGTGTCCTCACATGGTAGAAGG + Intronic
1069787767 10:71000207-71000229 CTGTGTCCTCATATGGCAGATGG + Intergenic
1070287255 10:75093005-75093027 TTGAGTTGTCAGGTGGAAGAGGG + Intergenic
1070706698 10:78644827-78644849 CTGTGTTCTCACATGGCAGAAGG + Intergenic
1070830071 10:79412682-79412704 CTTCGTACTCAGCTAGAAGAGGG - Intronic
1071407168 10:85348338-85348360 CTGAGAAAACAGATGCAAGAAGG + Intergenic
1071728565 10:88224262-88224284 CAGAGTTCTCACATGGCAGAAGG + Intergenic
1071837360 10:89431791-89431813 CTGAGTCTTCAGATTGAAGAGGG - Exonic
1071967021 10:90861982-90862004 ATGAGTACCTAGAGGGAAGAAGG - Intergenic
1072100174 10:92221869-92221891 CTGTGTCCTCACATGGCAGAAGG - Intronic
1072313613 10:94180816-94180838 CTGTGTCCTCACATGGCAGAAGG - Intronic
1072494669 10:95945033-95945055 CTGTGTCCTCACATGGCAGATGG - Intergenic
1072647689 10:97270788-97270810 CTGAGCACTCATCTGCAAGAAGG + Intronic
1073048164 10:100652119-100652141 CTGAGTGGTCAACTGGAAGAAGG - Intergenic
1073722458 10:106188576-106188598 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1073821611 10:107270873-107270895 CTGTGTTCTCACATGGGAGAAGG + Intergenic
1074850165 10:117433035-117433057 CTGTGGTCTCAGATGGCAGATGG + Intergenic
1075098264 10:119487924-119487946 CTGTGTCCTCACATGGTAGAAGG - Intergenic
1075133574 10:119762351-119762373 CTGAGTCCTCACATGGCAGGAGG + Intronic
1075301814 10:121331465-121331487 CAGAGGACTCAGTTGGGAGAAGG - Intergenic
1075350958 10:121724981-121725003 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1075436191 10:122444675-122444697 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1075872393 10:125780251-125780273 CTGTGTCCTCATATGGCAGACGG - Intergenic
1077890295 11:6413436-6413458 CTGAGAACACAGAGGGAAGGGGG - Intronic
1078299610 11:10114296-10114318 ATGAGATCTCAGATTGAAGATGG - Intronic
1078412696 11:11140439-11140461 CTGTGTCCTCACATGGTAGAAGG - Intergenic
1078735415 11:14015344-14015366 CTGTGTCCTCAGGTGGTAGAAGG + Intronic
1078846483 11:15123448-15123470 CTGAGTAACCAGATAGATGATGG + Intronic
1080029141 11:27642641-27642663 CTGTGTTCTCACATCGAAGAAGG - Intergenic
1080081847 11:28229601-28229623 CTGTGTCCTCACATGGCAGAAGG - Intronic
1080397284 11:31901942-31901964 CTGAGTCCTCACATGGCAGAAGG + Intronic
1080420936 11:32109922-32109944 CTGGGTCCTCACATGGCAGAAGG - Intergenic
1080792215 11:35531612-35531634 CTGAGTCCTCACATGGTGGAAGG + Intergenic
1080963943 11:37193228-37193250 GTGAGTACTGAGATGGTAGATGG + Intergenic
1083088363 11:60174249-60174271 CCAAGAACTCAGCTGGAAGATGG - Intronic
1084081106 11:66825528-66825550 CTGTGTCCTCACATGGCAGAAGG - Intronic
1084468414 11:69340908-69340930 CTTAGGACTGAGATGGCAGAGGG + Intronic
1084788129 11:71455629-71455651 CTGTGTCCTCACATGGTAGAAGG - Intronic
1085294300 11:75422162-75422184 CTGAGTCTTCACATGGGAGAGGG - Intronic
1085751612 11:79167233-79167255 CTGAGTTCACAGTGGGAAGAAGG + Intronic
1085765714 11:79279986-79280008 CTGTGTCCTCAAATGGCAGAGGG - Intronic
1087238201 11:95744696-95744718 CTGTGTTCTCACATGGCAGAAGG - Intergenic
1087570443 11:99920694-99920716 CTGTGTACTCACATGGTGGAAGG + Intronic
1087673666 11:101134255-101134277 TTGTGTACTCACATGGTAGAAGG - Intergenic
1087714016 11:101585866-101585888 TTGAGTACCCAGAAGGAATAAGG + Intronic
1087923147 11:103890055-103890077 CTGTGTCCTCACATGGCAGAGGG + Intergenic
1087978141 11:104575909-104575931 CTGTGTTCTCAGAGGGGAGAAGG - Intergenic
1088008039 11:104965982-104966004 CTGATTACTCAGGTGGGAGATGG - Intronic
1088324193 11:108585453-108585475 CTGTGTCCTCACATGGTAGAAGG - Intronic
1088495612 11:110429087-110429109 ATGAGTACCCTGATGGAGGAAGG + Intergenic
1089238750 11:117055854-117055876 CTGTGTCCTCACATGGCAGAAGG - Intronic
1089286730 11:117412239-117412261 GTGCTTTCTCAGATGGAAGAAGG - Exonic
1089333877 11:117709357-117709379 CTGTGTCCTCACATGGCAGATGG + Intronic
1089715859 11:120358442-120358464 CTGACTGATAAGATGGAAGATGG + Intronic
1089817816 11:121192177-121192199 CTGAGCACTGAGATGGATTAAGG + Intergenic
1090213016 11:124936114-124936136 CTGTGTATTCAGAGGGAAGTTGG - Exonic
1090641637 11:128734335-128734357 CTGAGTACTCAGATGGAAGAAGG + Intronic
1091553872 12:1557458-1557480 CTGTGTCCTCACATGGCAGAAGG + Intronic
1092747946 12:11691108-11691130 CTGTGTCCTCACATGGCAGAAGG + Intronic
1093262617 12:16957719-16957741 CTGAGTACACAGTAAGAAGATGG + Intergenic
1093269493 12:17041776-17041798 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1093680419 12:21995966-21995988 CTGAGTTCTTACATGGTAGAAGG - Intergenic
1093798567 12:23343761-23343783 CTGCTTCCTCACATGGAAGAAGG - Intergenic
1094005313 12:25742911-25742933 CTGTGCCCTCACATGGAAGAGGG + Intergenic
1094027422 12:25973746-25973768 CTGTGTCCTCACATGGTAGAAGG - Intronic
1094083109 12:26559460-26559482 CTGTGTCCTCACATGGTAGAAGG + Intronic
1095547509 12:43388908-43388930 CTGTGTTCTCATATGGAGGAAGG + Intronic
1096038179 12:48491283-48491305 CTGTGTCCTCACATGGAGGAAGG + Intronic
1096768820 12:53918809-53918831 CTGAGTTATCACATGGCAGAAGG + Intergenic
1097424562 12:59427523-59427545 CTGTGTCCTCACATGGGAGAAGG + Intergenic
1098015802 12:66103423-66103445 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1098327063 12:69313846-69313868 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1098345385 12:69497444-69497466 CTGTGTCCTCACATGGTAGAGGG + Intronic
1098424319 12:70342262-70342284 TTAAGTACTCAGATGGAACATGG - Exonic
1098847010 12:75550186-75550208 CTTAGAATTTAGATGGAAGAGGG - Intergenic
1099507500 12:83497652-83497674 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1099744097 12:86679683-86679705 CTGTGTCCTCACATGGTAGAAGG - Intronic
1100119570 12:91353193-91353215 CTGTGTTCTCAGATGGTGGAAGG + Intergenic
1100201062 12:92298293-92298315 CTGCATTCTCAGAGGGAAGAGGG + Intergenic
1100506369 12:95224680-95224702 CTGAGTAATCAAGTGGTAGATGG - Intronic
1100752190 12:97710583-97710605 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1100759040 12:97785941-97785963 CTGTGTTCTCACATGGCAGAAGG + Intergenic
1101059303 12:100954453-100954475 ATGGGTGCTCAGATGGAAGGTGG - Intronic
1101518018 12:105454983-105455005 CTGTGTCCTCACGTGGAAGAAGG - Intergenic
1101860917 12:108481774-108481796 CTGTGTCCTCACATGGAGGAAGG - Intergenic
1101919917 12:108924105-108924127 CTGTGTCCTCAGATGGCATAAGG - Intronic
1102438918 12:112946703-112946725 CAGGGGACTCAGAAGGAAGAAGG - Intronic
1102879496 12:116473519-116473541 CTGTATCCTCACATGGAAGAAGG - Intergenic
1103014478 12:117483024-117483046 CTGGGGAGTCAGAGGGAAGAAGG + Intronic
1103222122 12:119254724-119254746 CTGGGTCCTCACATGGCAGAAGG + Intergenic
1103657025 12:122479424-122479446 CTGAGACCTAAGATGGAAGCTGG + Intronic
1103931131 12:124451688-124451710 GTGAGTGATCAGATGGAACAGGG + Intronic
1104377352 12:128276547-128276569 CTGAGAACTCAGAAGGAGAAGGG - Intronic
1104509173 12:129360583-129360605 CTGGGTGATCAGATGGAAGGTGG - Intronic
1105518424 13:21110899-21110921 CTGCGTCCTCACATGGCAGAAGG - Intergenic
1105519317 13:21117366-21117388 CTGTGTCCTCATATGGCAGAGGG + Intergenic
1105697928 13:22908912-22908934 CTGCATCCTCACATGGAAGAAGG + Intergenic
1106573619 13:30954001-30954023 CTGTTTACTCAGCTGGAACATGG + Intronic
1106782723 13:33075887-33075909 CTGTGTACTCACATGGTAGAAGG + Intergenic
1107389940 13:39953312-39953334 TTGAGTACTTAAAGGGAAGATGG + Intergenic
1107414041 13:40184621-40184643 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1107634102 13:42374598-42374620 CTGTGTCCTCACATGGAGGAAGG + Intergenic
1107748853 13:43542896-43542918 CTGAGTTCTCACATGGTGGAAGG + Intronic
1107876084 13:44791576-44791598 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1107942747 13:45389062-45389084 CCAAGTATTCAGATGGAAGTTGG + Intergenic
1108617822 13:52151690-52151712 ATGTGTTCTCAGATGGAAAACGG - Intronic
1108679508 13:52767387-52767409 CTGTGTCTTCACATGGAAGAAGG - Intergenic
1108745068 13:53385173-53385195 CTGCGTCCTCACATGGCAGATGG + Intergenic
1109330005 13:60917910-60917932 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1109330229 13:60919912-60919934 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1109752886 13:66719451-66719473 CTGAGTCCTCACATGGTGGAGGG - Intronic
1109874259 13:68378754-68378776 CTGTGTACTCACATGGCAGAAGG + Intergenic
1110076810 13:71256238-71256260 CTGTGTGCTCACATGGCAGAAGG + Intergenic
1110601733 13:77382511-77382533 CTGAGTACTTAGCTGGAATCTGG + Intergenic
1111258716 13:85706787-85706809 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1112263731 13:97902937-97902959 CTGTGTCCTCATATGGCAGAAGG - Intergenic
1112283442 13:98082834-98082856 CTGTGTCCTCATATGGTAGAAGG - Intergenic
1112884031 13:104147007-104147029 CTGTGTGCTCACATGGTAGAAGG + Intergenic
1112906575 13:104429747-104429769 CTGTGTCCTAAGATGGCAGAAGG + Intergenic
1113074167 13:106451726-106451748 CTGGGTCCTCACATGGCAGAAGG - Intergenic
1113131805 13:107045318-107045340 CTGAGTTCTCACGTGGCAGAGGG - Intergenic
1113178093 13:107589899-107589921 CTGACATCTCAGATGAAAGATGG + Intronic
1113492576 13:110704003-110704025 CTGTGTCCTCACATGGTAGAAGG - Intronic
1113971362 13:114193475-114193497 CTGTGTCCTCATATGGCAGATGG + Intergenic
1114260001 14:21029756-21029778 CTGTGTCCTCACATGGTAGAAGG - Intronic
1114552695 14:23542624-23542646 CTGAGTGCTCATACAGAAGAAGG - Intronic
1114584535 14:23798279-23798301 CTGTCTCCTCACATGGAAGAAGG - Intergenic
1114662902 14:24360021-24360043 CTGAATATACAGATGGAAAATGG + Intergenic
1114731290 14:24995184-24995206 CTGTGTACTCACATGGTAGAAGG + Intronic
1114838357 14:26232027-26232049 CTGTGTCCTCACATGGTAGATGG - Intergenic
1114838564 14:26234227-26234249 CTGAGTCTTCACATGGCAGAAGG + Intergenic
1115014290 14:28590949-28590971 CTTGGTCCTCAGATGGCAGACGG + Intergenic
1115373875 14:32651614-32651636 CTGTGTCCTCACATGGCAGAAGG + Intronic
1115714594 14:36088866-36088888 TTAAGTACACAGTTGGAAGAAGG + Intergenic
1115909421 14:38239173-38239195 CTGAGTCAACACATGGAAGATGG + Intergenic
1116360098 14:43983421-43983443 ATGAGTAGTCATATGGAAAAGGG + Intergenic
1117202518 14:53406777-53406799 CTGTGTCCTCAGATGGCAGAAGG - Intergenic
1117352048 14:54890899-54890921 CTGTGTAGTCAGAGGGAAGCTGG - Intronic
1117514356 14:56485682-56485704 CTGAGTCCTCACATGGTGGAAGG - Intergenic
1117733080 14:58743481-58743503 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1117976949 14:61308455-61308477 CTGAGTACTAAGATGAAACTTGG - Intronic
1118401033 14:65379877-65379899 CTGGGTCCTCACCTGGAAGAAGG + Intergenic
1118437854 14:65787765-65787787 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1118482343 14:66179835-66179857 GTGAGTACAAAGAGGGAAGATGG - Intergenic
1119502276 14:75140033-75140055 CTGTGTTCTCACATGGAGGAAGG - Intronic
1119537262 14:75412628-75412650 CTGTGTCCTCACATGGTAGAAGG - Intergenic
1119604326 14:76001792-76001814 CTGAGTAATCCCATGGCAGAAGG + Intronic
1120087655 14:80293325-80293347 CTGAGTTCTCATATGGTAAAAGG + Intronic
1120106442 14:80500982-80501004 CTGAGCACTTAGAAGCAAGATGG - Intronic
1120150075 14:81022946-81022968 CTGTGTCCTTAGATGGCAGAAGG - Intronic
1120413156 14:84184060-84184082 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1120566719 14:86068755-86068777 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1120924567 14:89784762-89784784 CTGTGTCCTCACATGGTAGAAGG - Intergenic
1121728743 14:96171867-96171889 CTGAGTCCTCACATGGCAGAAGG + Intergenic
1121873391 14:97429815-97429837 CTATGTCCTCAGATGGCAGAAGG + Intergenic
1122304697 14:100755511-100755533 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1122671528 14:103376389-103376411 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1122810674 14:104286267-104286289 CTGTGTCCTCACATGGAGGACGG + Intergenic
1123072259 14:105647595-105647617 CTGAGTGCACAGATGGGAGGAGG - Intergenic
1123574757 15:21655911-21655933 CTGAGTGCTCAGGTGGGAGTGGG - Intergenic
1123611372 15:22098407-22098429 CTGAGTGCTCAGGTGGGAGTGGG - Intergenic
1123767831 15:23499438-23499460 TTGAGTCCTCATATGGCAGAAGG - Intergenic
1124839541 15:33229014-33229036 CTTTGTACTCACATGGCAGAAGG + Intergenic
1125839236 15:42783276-42783298 CTGAGTCCTCATGTGGTAGATGG - Intronic
1125962699 15:43845435-43845457 CTGTGTCCTCATATGGTAGAAGG - Intronic
1126200343 15:45978678-45978700 CTGTGTCCTCACATGGAAGAAGG + Intergenic
1126565300 15:50090509-50090531 CTGTGTCCTCACATGGCAGAAGG - Intronic
1126964029 15:54030786-54030808 CTGTGTCCTCAGGTGGCAGAAGG + Intronic
1126993057 15:54406017-54406039 CTGAGGACTCAGAGGATAGAAGG - Intronic
1127795233 15:62432384-62432406 CTGTGTCCTCACATGGTAGAAGG + Intronic
1128368018 15:67018433-67018455 CTGGGAACACAGATGGAAGAAGG - Intergenic
1129274350 15:74435243-74435265 CTCAGGACTCTGAGGGAAGAAGG - Intergenic
1129504332 15:76068643-76068665 CTGTGTCCTCACATGGAAGCAGG - Intronic
1129630013 15:77248566-77248588 CTGTGTCCTCACATGGCAGAAGG - Intronic
1129911380 15:79229942-79229964 CTGTGTCCTCATATGGCAGAAGG - Intergenic
1130405984 15:83602453-83602475 CTGTGTCCTCACATGGCAGAAGG + Intronic
1130429607 15:83833349-83833371 CTGTGTCCTCACATGGCAGAAGG + Intronic
1131132200 15:89907517-89907539 CTGAGTCCTCACATGGCAGAAGG - Intronic
1131539952 15:93267656-93267678 CTGTGTCCTCACATGGTAGAGGG + Intergenic
1131560745 15:93437250-93437272 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1131975289 15:97939759-97939781 CTGTGTTCTCACATGGCAGAAGG - Intergenic
1132025257 15:98399648-98399670 CTGTGTGCTCACATGGAGGAAGG - Intergenic
1202983624 15_KI270727v1_random:390163-390185 CTGAGTGCTCAGGTGGGAGTGGG - Intergenic
1133106628 16:3514711-3514733 CTGAGTCCTCACATGGCAGCAGG + Intronic
1133407512 16:5537036-5537058 GTGAGTACTCAAAAGGAAGTGGG - Intergenic
1133625168 16:7564221-7564243 CTGTGTTCTCAGATGGAAGAGGG - Intronic
1135290947 16:21237559-21237581 CTGTGTCCTCACATGGAGGAAGG + Intronic
1136079306 16:27841154-27841176 CTGTGTCCTCAGCTGGAAAATGG - Intronic
1137344231 16:47639594-47639616 CAGAGTACTCAGATCTAAAATGG - Intronic
1137510020 16:49090973-49090995 GTGAGCATTCAGATGGAGGAAGG - Intergenic
1137758264 16:50919655-50919677 CTGAACACCCACATGGAAGAGGG - Intergenic
1139011111 16:62635532-62635554 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1139022812 16:62772857-62772879 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1140231094 16:73117833-73117855 CTGTGTCCTCATATGGTAGAAGG - Intergenic
1140706875 16:77638972-77638994 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1140777650 16:78264756-78264778 CTGTGTCCTCACATGGCAGAAGG - Intronic
1142347211 16:89561485-89561507 CTCAGCAATCAGATGGAAAAGGG - Intronic
1144382490 17:14716478-14716500 CTGTGTTCTCACATGGTAGACGG + Intergenic
1144437916 17:15257965-15257987 CTGGGTACTGAGCTGTAAGAGGG + Intronic
1144457014 17:15427009-15427031 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1144823025 17:18088641-18088663 CTGTGTACTAAGATGGAGCAGGG - Intronic
1144938155 17:18916812-18916834 CTGTGTCCTCAGATGGTGGAAGG + Intronic
1145378411 17:22373054-22373076 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1146570140 17:33945387-33945409 CTGTTAACTCAGATGGAACAAGG + Intronic
1147019586 17:37520850-37520872 CTGAGTTCTCAGAGGTCAGAGGG - Intronic
1147324173 17:39662540-39662562 CTCAGGACTCAGAGGTAAGAAGG - Intronic
1148685959 17:49501415-49501437 ATGAAGACTCAGAGGGAAGATGG + Intronic
1148819077 17:50349856-50349878 ATGATTACTCAGATGGGAGGAGG - Intronic
1148971583 17:51487891-51487913 GTGTGTACTCAGATGGTTGATGG + Intergenic
1148971937 17:51491261-51491283 CTGTGTCCTCACATGGAAGAAGG - Intergenic
1149258632 17:54855477-54855499 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1149344116 17:55717036-55717058 CTGTGCCCTCAGATGGTAGAAGG - Intergenic
1149726848 17:58903696-58903718 TTGAGTTCTTAGAAGGAAGAGGG + Intronic
1150583889 17:66500112-66500134 CTGTGTACTCACATGACAGAAGG - Intronic
1150600663 17:66648113-66648135 CTGTGTCCTCACATGGCAGAAGG + Intronic
1150731078 17:67694458-67694480 CTGAGCACTGAGAGGGAAGCAGG - Intronic
1151532797 17:74717867-74717889 CTGTGTCCTCACATGGTAGAAGG - Intronic
1152346377 17:79754855-79754877 CTGTGTCCTCACATGGAGGAAGG + Intergenic
1152435040 17:80271350-80271372 CTGAGTACTCAAAGGGAAAAAGG + Intronic
1153339230 18:3957225-3957247 CTGAGTTTGGAGATGGAAGAAGG + Intronic
1154179467 18:12119525-12119547 CTGTGTCCTCACATGGCAGAAGG + Intronic
1155233422 18:23796007-23796029 CTGGGTCCTCACATGGTAGAGGG - Intronic
1155700490 18:28737107-28737129 CTGTGTACACACATGGCAGAAGG - Intergenic
1155769661 18:29680920-29680942 CTGGGTCCTCACATGGTAGAAGG + Intergenic
1156685297 18:39637693-39637715 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1156931444 18:42649641-42649663 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1157301752 18:46484438-46484460 CTGTGTCCTCACATGGCAGAAGG - Intronic
1157436885 18:47677890-47677912 CTGTGTCCTCACATGGTAGAAGG + Intergenic
1157942666 18:51946133-51946155 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1158010107 18:52718984-52719006 CTGAGTTTTCAGAGGGAAAATGG - Intronic
1158094509 18:53755524-53755546 CTGTGTTCTCACATGGCAGAAGG + Intergenic
1158149787 18:54355530-54355552 CAGTGTCCTCACATGGAAGAAGG - Intronic
1158396220 18:57080146-57080168 CTGTGTGCTCACATGGCAGAAGG - Intergenic
1158499704 18:57989385-57989407 CTGATTCCTCACATGGCAGACGG - Intergenic
1158582223 18:58693686-58693708 CTGAGTAACCAGATGGATGGTGG + Intronic
1158727566 18:59987384-59987406 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1158831789 18:61287593-61287615 GTGAGTACTCAGAGGGAAACAGG + Intergenic
1159106346 18:64005518-64005540 CTGTGTACTCACATGGCAGAGGG - Intronic
1159479779 18:68974264-68974286 CTGGGTCCTCACATGGCAGAAGG - Intronic
1159536961 18:69726787-69726809 CTGTGTCCTCACATGGTAGATGG + Intronic
1159579427 18:70218612-70218634 CTGAGGACACAGAGAGAAGATGG - Intergenic
1160132655 18:76242151-76242173 CTGTGTCCTCACATGGTAGAAGG - Intergenic
1160337633 18:78056945-78056967 CTGAGTCCTCACCTGGCAGAAGG - Intergenic
1161652459 19:5493589-5493611 CCGAGGACTCAGACAGAAGAGGG - Intergenic
1164622680 19:29706564-29706586 CTGAGCACTGAGATGGAGGTGGG + Intronic
1164683220 19:30149797-30149819 CTGAGGTCTCAGGTGGGAGAAGG + Intergenic
1165539805 19:36483435-36483457 CTGAGCCCAGAGATGGAAGAGGG + Intronic
1165600086 19:37047349-37047371 CTGTGTCCTCACATGGCAGAAGG - Intronic
1167311591 19:48740434-48740456 CTGGGTCCTGGGATGGAAGATGG + Intronic
1167845339 19:52158999-52159021 CTGTGTCCTCACATGGCAGAAGG - Intronic
925676129 2:6362834-6362856 CTGAGTTCTCACATGGTGGAAGG + Intergenic
925880638 2:8349604-8349626 CTGTGTCCTCACATGGCAGAAGG + Intergenic
926747021 2:16167188-16167210 CAGAAAACTCAGATAGAAGAGGG - Intergenic
926946161 2:18189604-18189626 TTCAATACTTAGATGGAAGAGGG - Intronic
927515600 2:23670068-23670090 CTGAGAACCCAGATGCAGGAAGG - Intronic
928307158 2:30179639-30179661 CTGTGTCCTCACATGGCAGAAGG + Intergenic
928310368 2:30204737-30204759 CTCAGTCCCCAGATGGAAGAAGG + Intergenic
928681643 2:33708741-33708763 CCGAGTGATCAGATGCAAGAGGG + Intergenic
929314959 2:40465935-40465957 CTGTGTCCTCACATGGCAGAAGG - Intronic
929615231 2:43301517-43301539 CTGGGTACTGAGATGGAATAGGG - Intronic
929797852 2:45073735-45073757 CTGTGTCCTCACATGGCAGAGGG - Intergenic
930043965 2:47152378-47152400 CTGAGTGCTCAGTGGAAAGATGG - Intronic
930253667 2:49064466-49064488 CTGAGTCCTCACATGGTGGAAGG - Intronic
930394024 2:50796985-50797007 CTGTGTCCTCACATGGCAGAAGG + Intronic
930505714 2:52280990-52281012 CTGTGTTCTCAGATGGAGGAAGG + Intergenic
931210202 2:60186487-60186509 CTGTGTCCTCACATGGCAGAAGG + Intergenic
931831453 2:66055920-66055942 CTGTGTTCTCACATGGAAGAAGG - Intergenic
932136658 2:69237012-69237034 CTGTGTAATCAGATGGAAAAAGG + Intronic
932837679 2:75052257-75052279 CTAAGTCCTCAGATGGTGGAAGG - Intronic
933107911 2:78356713-78356735 CTGTGTCCTCACATGGCAGAAGG + Intergenic
933895783 2:86808648-86808670 CTGGGCCCCCAGATGGAAGACGG - Intergenic
935180621 2:100687371-100687393 CTGTGTCCTCACATGGAGGAAGG - Intergenic
935207318 2:100907403-100907425 CCTTGTACTCAGATGGAAAAAGG + Intronic
935463657 2:103368799-103368821 CTGGGTACTCACATGGTAAAAGG + Intergenic
935478678 2:103557951-103557973 CTGTGTCCTCACATGGCAGAAGG + Intergenic
935708585 2:105877555-105877577 CTGTGTCTCCAGATGGAAGAGGG - Intronic
935716455 2:105943509-105943531 CTGTGTCCTCACATGGCAGAAGG + Intergenic
935851434 2:107224372-107224394 CTGCGTCCTCACATGGTAGAAGG + Intergenic
936254282 2:110897468-110897490 CTGAGTCCTCACATGGCAGAAGG + Intronic
936311444 2:111388383-111388405 CTGTGTCCTCACATGGTAGAGGG - Intergenic
936450949 2:112633704-112633726 CTGTGTCCTCAGATGAAGGAAGG - Intergenic
936596902 2:113856785-113856807 CTGTGTCCTCACATGGCAGAAGG - Intergenic
937055408 2:118930900-118930922 CTGTGTGCTCACATGGCAGATGG + Intergenic
937282785 2:120731751-120731773 CTGAGTCCTCACATGGAGGAAGG - Intergenic
937782881 2:125859482-125859504 CTGTGTCCTCACATGGTAGAAGG + Intergenic
938230300 2:129653343-129653365 ATGAGTACCCAGATGGAGGGTGG + Intergenic
938737811 2:134202362-134202384 CTGTGTACTCAAATGGCAGAAGG - Intronic
938974723 2:136465276-136465298 CTGTGTCCTCACATGGCAGAAGG + Intergenic
939839515 2:147170121-147170143 CTGTGTTCTCACATGGCAGAAGG - Intergenic
940121086 2:150266850-150266872 CTATGTCCTCAGATGGCAGAAGG + Intergenic
940285564 2:152029787-152029809 CTGTGTCCTCAAATGGTAGAAGG - Intronic
940372571 2:152919115-152919137 CTGTGTCCTCACATGGCAGAAGG - Intergenic
940669655 2:156651230-156651252 CTGTGTTCTCACATGGCAGAAGG + Intergenic
940765248 2:157783264-157783286 CTAAGTACACAGATGCAGGAAGG + Intronic
941873746 2:170412448-170412470 CTGAGTCTTCAGACAGAAGAAGG - Intronic
942814945 2:180042032-180042054 CTGGGTCCTCACATGGAAGAAGG - Intergenic
942855653 2:180543965-180543987 CTGTGTTCTCACATGGTAGAAGG - Intergenic
943818899 2:192293158-192293180 CTGTGTCCTCACATGGTAGAAGG + Intergenic
944073280 2:195697058-195697080 CTGAGGACAGAGGTGGAAGAGGG + Intronic
944384336 2:199147884-199147906 CTGTGTCCTCACATGGTAGAAGG - Intergenic
944467605 2:200018786-200018808 CTGTGTCCTCACATGGCAGAAGG + Intergenic
944650916 2:201829456-201829478 CTGAGTATTAAAATGGATGATGG + Intronic
945322016 2:208435556-208435578 CTGACTTCGAAGATGGAAGAAGG + Intronic
945930721 2:215852544-215852566 CTGTGTCCTCACATGGCAGAAGG + Intergenic
946049095 2:216846840-216846862 CTGAGTCATCATATGGGAGAAGG + Intergenic
946443152 2:219713976-219713998 CTGAGACCTCATATGGCAGAAGG - Intergenic
946447916 2:219755360-219755382 CTGTGTCCTCATATGGTAGAAGG - Intergenic
946637703 2:221747863-221747885 CTGTGTCCTCACATGGCAGAAGG - Intergenic
946703037 2:222431682-222431704 CTGAGAGCTTAGATGGCAGAGGG + Intronic
947047433 2:226004498-226004520 CTGTGTCCTCATATGGTAGAAGG + Intergenic
947082582 2:226415224-226415246 CTGAATCCTCATATGGCAGAAGG - Intergenic
947615487 2:231554470-231554492 CTGAGTACACAGACGAAGGAAGG - Intergenic
947830773 2:233139996-233140018 CTGAGGGCTCAGGAGGAAGAGGG + Intronic
948120710 2:235528323-235528345 CTGAGTGCACAGATGGTGGATGG - Intronic
948511332 2:238467184-238467206 CTGTGTCCTCACATGGCAGAGGG + Intergenic
948618000 2:239213833-239213855 ATGAGTACACAGCTGGATGAGGG + Intronic
948654845 2:239470221-239470243 CTGTGTACCCATATGGCAGAAGG - Intergenic
1168865363 20:1081372-1081394 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1169737294 20:8850682-8850704 CTGTGTCCTCACATGGCAGAAGG - Intronic
1169823671 20:9742401-9742423 CTCATTAATCAGATGGAAGTGGG + Intronic
1169830832 20:9823140-9823162 CTGTGTCCTCACATGGCAGAAGG - Intronic
1169877159 20:10310732-10310754 CTGTGTCCTCACATGGAGGAAGG + Intergenic
1169998139 20:11582615-11582637 CTGACAACTGAGAGGGAAGAAGG - Intergenic
1170299960 20:14872480-14872502 CTGATTACTGAAATGGTAGAAGG - Intronic
1170803096 20:19606679-19606701 CTGAGAATGCAGAGGGAAGAAGG + Intronic
1170946811 20:20898775-20898797 CTGTGTCCTCATATGGTAGAGGG - Intergenic
1171031311 20:21679288-21679310 CTGTGTCCTCACATGGTAGAAGG + Intergenic
1171416609 20:24985798-24985820 GTGAGGTCTCAGAAGGAAGAGGG + Intronic
1171524866 20:25800936-25800958 CTGTGTCCTCACATGGCAGAAGG + Intronic
1171551961 20:26054947-26054969 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1171793071 20:29546247-29546269 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1171855380 20:30338159-30338181 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1173904806 20:46618593-46618615 CTGTGTCCTCACATGGCAGAAGG - Intronic
1173917922 20:46723363-46723385 GTGGCTACTAAGATGGAAGAGGG - Intronic
1174289243 20:49496013-49496035 CTGAGTATATAGATGGATGAGGG - Intergenic
1175170777 20:57079931-57079953 CTGAGGACTCAGATCTAAGGTGG - Intergenic
1175744080 20:61441656-61441678 ATGTGTGCTCACATGGAAGACGG - Intronic
1176037353 20:63046172-63046194 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1176132300 20:63501359-63501381 CTGTGTCCTCACATGGGAGAAGG - Intergenic
1177006246 21:15675872-15675894 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1177208941 21:18045820-18045842 CTGTGTCCTCACATGGCAGAAGG - Intronic
1177394847 21:20520445-20520467 CTGTGTCCTCACATGGTAGAAGG + Intergenic
1178071408 21:28972152-28972174 CTGTGTCCTCACATGGCAGAAGG - Intronic
1178305288 21:31486083-31486105 GTGAATCCTCAGGTGGAAGAGGG - Intronic
1178352762 21:31884639-31884661 CTGAGTCCTCATATGGTGGAAGG - Intronic
1178383192 21:32128687-32128709 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1178458293 21:32776586-32776608 CTGAGTCCTCACATGGTGGAAGG + Intergenic
1178905733 21:36634524-36634546 CTGTGTCCTCACATGGTAGAAGG + Intergenic
1179131496 21:38641290-38641312 CTGTGTCCTCAAATGGTAGAAGG - Intronic
1179149824 21:38800215-38800237 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1179194052 21:39149110-39149132 CTGTGTTCTCATATGGCAGAAGG + Intergenic
1179267280 21:39814899-39814921 CTGTGTACTCATATGGCAGCTGG - Intergenic
1179425217 21:41272403-41272425 CAGAGTACTCAAAAGGAAGAAGG - Intronic
1179436314 21:41364408-41364430 CTGAGGACCCTGGTGGAAGATGG + Intronic
1179503279 21:41823085-41823107 CTGTGTCCTCACATGGTAGAAGG - Intronic
1179935256 21:44599968-44599990 CTAAGTGCCCAGATGGAAGAGGG + Intronic
1181118333 22:20648277-20648299 CTGAGTTCTCAAAGGCAAGATGG + Intergenic
1182817640 22:33180014-33180036 CTGTGTCCTCACATGGCAGAAGG - Intronic
1182943584 22:34301210-34301232 GAGAGAACTCAGAGGGAAGAAGG + Intergenic
1183112488 22:35660721-35660743 CTGTGTTCTCACATGGCAGAAGG + Exonic
1184559782 22:45255542-45255564 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1184804185 22:46781818-46781840 CGGGGCTCTCAGATGGAAGAGGG - Intronic
1185180303 22:49356279-49356301 CTGAGGTCTCAGATGGAAAGGGG - Intergenic
949267393 3:2174475-2174497 GTGAGAACTCAGAGAGAAGAAGG - Intronic
949625607 3:5863302-5863324 GTCAGATCTCAGATGGAAGAGGG + Intergenic
949726921 3:7059779-7059801 CTGAGTTCTCACATGGCAGAAGG - Intronic
950832463 3:15888208-15888230 CTGTGTTCTCACATGGTAGAAGG - Intergenic
951021580 3:17786677-17786699 CTGAGTCCTCATGTGGAGGAAGG - Intronic
951480231 3:23153106-23153128 CTGTGTCCTCACATGGTAGAAGG + Intergenic
951626317 3:24667652-24667674 CTGTGTTCTCACATGGCAGAAGG - Intergenic
952011422 3:28904527-28904549 CTGTGTCCTCACATGGCAGAAGG + Intergenic
953437879 3:42894159-42894181 CTGTGTCCTCATATGGCAGAAGG + Intronic
953747784 3:45588167-45588189 CTGTGTCCTCACATGGTAGAAGG - Intronic
953896626 3:46808219-46808241 CTGAGTACCCACAGGGAGGAGGG - Intronic
954876696 3:53807073-53807095 CTGAGAACACAGGTGGAGGAGGG - Intronic
954914328 3:54135927-54135949 TTGAGGCCACAGATGGAAGAAGG + Intronic
955241644 3:57183234-57183256 CTGTGTCCTCACATGGCAGAAGG + Intergenic
956271571 3:67453418-67453440 CTGTGTCCTCACATGGCAGAAGG + Intronic
956564970 3:70625994-70626016 CTGTGTCCTCACATGGTAGAAGG - Intergenic
956689554 3:71863426-71863448 CTGTGTCCTCACATGGCAGAAGG + Intergenic
956758361 3:72412967-72412989 CTGTGTCCTCACATGGCAGAAGG - Intronic
956919189 3:73908274-73908296 CTGTGTCCTCACATGGCAGAAGG - Intergenic
957144054 3:76398869-76398891 CTGAGTATGAAGATGGAAGAAGG + Intronic
957310304 3:78510337-78510359 CTGTGTCCTCACATGGCAGAAGG + Intergenic
958069905 3:88596915-88596937 CTGTGTCCTCACATGGCAGAAGG - Intergenic
958124279 3:89335280-89335302 CTGGGTCCTCAGATGATAGAAGG + Intronic
958163280 3:89846426-89846448 CTGAGTCCTCACATGGCAGAAGG - Intergenic
958189395 3:90165586-90165608 CTGTGTCCTCACATGGTAGAAGG + Intergenic
958594205 3:96201124-96201146 CTGAGTGCTTAGATGGTAGTTGG - Intergenic
958686799 3:97408670-97408692 CTGTGTCCTCACATGGCAGAAGG + Intronic
958966565 3:100564905-100564927 ATCAGTACTGAGATGGAAGGTGG - Intronic
959470382 3:106742740-106742762 ATGTGTCCTCAGATGGAAGAAGG + Intergenic
959568006 3:107852501-107852523 CTGTGTCCTCCCATGGAAGAAGG - Intergenic
959585762 3:108023691-108023713 CTGAGTATCCAGATTGAGGAGGG - Intergenic
959885808 3:111498054-111498076 CTGATTCTTCAGATGGAAGGTGG - Intronic
960323175 3:116262941-116262963 CTGAGTGCTCAGTGAGAAGAAGG + Intronic
960419752 3:117429412-117429434 GTGAGTTCTCTGATGGGAGATGG + Intergenic
960460026 3:117922256-117922278 CTGAATACTCAAAGGGAGGAGGG - Intergenic
960878033 3:122315975-122315997 CTGAGAATGAAGATGGAAGATGG - Intergenic
961689227 3:128656416-128656438 CTGGGTGTTCATATGGAAGAAGG + Intronic
962137744 3:132755258-132755280 CTGAGAACTTTGATAGAAGAGGG + Intergenic
962252579 3:133845361-133845383 CTGCGTCCTCACATGGCAGAGGG - Intronic
962467482 3:135673874-135673896 CTGTGTGCTCACATGGCAGAAGG + Intergenic
962577858 3:136771102-136771124 CTGTGTCCTCATATGGAGGAAGG - Intergenic
963896783 3:150694968-150694990 CTGTGTCCTCACATGGTAGAAGG + Intronic
963908427 3:150793774-150793796 CTGTGTCCTCACATGGTAGAAGG - Intergenic
964634339 3:158843730-158843752 CTGAGAACCCAGAGGGCAGATGG - Intergenic
964885140 3:161473363-161473385 CTGTGTACTCACATGGTGGAAGG + Intergenic
966008462 3:175047023-175047045 CTGTGTCCTCAGATGGTGGAAGG + Intronic
966226698 3:177605515-177605537 CTGTGTCCTCACATGGTAGAAGG - Intergenic
966288750 3:178329581-178329603 CTGTGTCCTCACATGGCAGAAGG + Intergenic
966433354 3:179855767-179855789 CTGGGTCCTCACATGGCAGAAGG - Intronic
967719608 3:192801606-192801628 CTGTGTCCTCACATGGCAGAAGG - Intronic
967791924 3:193559138-193559160 GTGAGTTCTCAGATGAAAGATGG - Intronic
969081367 4:4621173-4621195 CTGTGTTCTCACATGGCAGAAGG + Intergenic
969189306 4:5504102-5504124 CTGCGTCCTCACATGGTAGAAGG - Intergenic
969909863 4:10434029-10434051 CTGAATTCTCACATGGTAGAAGG - Intergenic
970162718 4:13205358-13205380 CTGTGTCCTCACATGGCAGAAGG + Intergenic
970447614 4:16137094-16137116 CTGAGGCCTCAGCTGGCAGAAGG - Intergenic
970550673 4:17177960-17177982 CTGTGTCCTCACATGGAGGAAGG + Intergenic
970756508 4:19433273-19433295 CTGTGTTCTCATATGGCAGAAGG + Intergenic
970831686 4:20347121-20347143 ATTAGTAGCCAGATGGAAGATGG + Intronic
970871282 4:20819775-20819797 CTGTGTCCTCACATGGTAGAAGG - Intronic
970964564 4:21913404-21913426 CTGTGTCCTCACATGGCAGAAGG - Intronic
971047182 4:22817790-22817812 CTGTGTCCTCATATGGCAGAAGG - Intergenic
971072159 4:23106231-23106253 CTGGGTCCTCAGATTGCAGAGGG + Intergenic
972142307 4:35976089-35976111 CTGTGTTCTCACATGGCAGAAGG + Intronic
972181369 4:36470847-36470869 CTGTGTCCTCACATGGCAGAAGG - Intergenic
972257255 4:37370515-37370537 CTGAGTAAGCATTTGGAAGAGGG + Intronic
972803758 4:42506310-42506332 CTGTGTTCTCACATGGTAGAAGG - Intronic
973062862 4:45750927-45750949 CTGTGTCCTCACATGGCAGAAGG + Intergenic
973558504 4:52110143-52110165 CTGTGTCCTCATATGGCAGAGGG - Intergenic
973766126 4:54164670-54164692 CTGTGTCCTCACATGGCAGAAGG + Intronic
974202033 4:58655152-58655174 CTGTGTCCTCACATGGCAGAAGG + Intergenic
974308821 4:60176566-60176588 CTGAGTCCTCACATGGAAGAAGG - Intergenic
974356642 4:60821074-60821096 AAGAGTAATCAGATTGAAGATGG - Intergenic
974551996 4:63387954-63387976 CTGTGTCCTCATATGGTAGAGGG + Intergenic
974821462 4:67071374-67071396 CTGTGTCCTCACATGGCAGAGGG - Intergenic
974837285 4:67266227-67266249 CTGTGTCCTCAGGTGGCAGAAGG + Intergenic
975241840 4:72068329-72068351 CTGTGTCCTAAGATGGCAGAAGG + Intronic
975409026 4:74026181-74026203 CTGAGTTCTCACATGGTGGATGG - Intergenic
975707198 4:77122888-77122910 CTGATTACTCAGGTAGGAGATGG - Intergenic
975713929 4:77187696-77187718 CTGTGTACTCACATGGTAAAAGG - Intronic
975923786 4:79424447-79424469 CTGCGTCCTCACATGGTAGAAGG + Intergenic
975974777 4:80082195-80082217 CTGTGTCCTCAGATGGCAGAAGG + Intronic
976666568 4:87600562-87600584 CTGAGTCTTCACATGGTAGAAGG - Intergenic
976899142 4:90152440-90152462 CTGAGTATTCAGCTGCATGATGG + Intronic
977085469 4:92591212-92591234 CTGAGTCCTCGAATGGCAGAAGG - Intronic
977191069 4:94001331-94001353 CTGTGTCCTCACATGGTAGAAGG + Intergenic
977490705 4:97706427-97706449 CTGTGTCCTCACATGGCAGAAGG - Intronic
977644026 4:99391026-99391048 CTGTGTACTCACATGGAAAAAGG + Intergenic
977748467 4:100579864-100579886 CTGTGTCCTCACATGGCAGAAGG - Intronic
977748602 4:100581009-100581031 CTGTGTCCTCACATGGCAGAAGG - Intronic
977880495 4:102198942-102198964 CTGTGTCCTCACATGGCAGAAGG + Intergenic
977959823 4:103072987-103073009 CTGTGTTCTCAGATGGTGGAAGG - Intronic
978099140 4:104815276-104815298 CTGTGTACTCACATGACAGAAGG - Intergenic
978367934 4:108002122-108002144 CTGTGTCCTCATATGGCAGAAGG - Intronic
978407210 4:108392902-108392924 CAGAGTATTCAAATTGAAGAAGG - Intergenic
978964446 4:114724604-114724626 CTGTGTTCTCACATGGCAGAAGG - Intergenic
979071220 4:116209140-116209162 CTGTGTTCTCACATGGTAGAAGG - Intergenic
979174388 4:117644490-117644512 CTGTGTCCTCACATGGCAGAAGG + Intergenic
979471361 4:121101346-121101368 ATGTGTTCTCACATGGAAGAAGG - Intergenic
980614588 4:135202332-135202354 CTGTGTCCTCACATGGAGGAAGG - Intergenic
980662324 4:135878579-135878601 CTGTGTCCTCACATGGCAGAAGG - Intergenic
981340875 4:143619977-143619999 CTGAATATACAGATGGAAAATGG + Intronic
981377559 4:144033419-144033441 CTGTGTCCTCACATGGCAGAAGG - Intergenic
981573949 4:146184091-146184113 CTGAGTCCTCACGTGGCAGAAGG + Intronic
981985258 4:150846558-150846580 CTCAGAACTCAGAAGGATGAGGG + Intronic
982401644 4:154974344-154974366 CTGCGTCCTCACATGGCAGAAGG - Intergenic
982627654 4:157787669-157787691 ATGAGTAGTCAGATTGAAGAGGG - Intergenic
982951193 4:161698147-161698169 CTGTGTCCTCACATGGCAGAAGG - Intronic
983143813 4:164187976-164187998 CAGAATACTCAGATTGAACATGG + Intronic
983500638 4:168495397-168495419 CTGTGTCCTCACATGGCAGAAGG - Intronic
983826526 4:172268789-172268811 CTGTGTTCTCACATGGAAGAGGG - Intronic
983849684 4:172565077-172565099 CTGTGCTCTCACATGGAAGAAGG + Intronic
983980845 4:173995152-173995174 CAGAGATCTCAAATGGAAGAAGG + Intergenic
984621357 4:181956115-181956137 CCGTGTTCTCACATGGAAGAAGG + Intergenic
984863387 4:184259187-184259209 CTGTGTCCTCACATGGCAGAAGG - Intergenic
984900649 4:184583230-184583252 CTGTGTCCTCACATGGCAGAAGG - Intergenic
985254736 4:188058473-188058495 CTGTGTCCTCACATGGCAGAAGG + Intergenic
985819869 5:2152331-2152353 CTCATTGCACAGATGGAAGATGG + Intergenic
985819872 5:2152366-2152388 CTCATTGCACAGATGGAAGATGG + Intergenic
985819875 5:2152401-2152423 CTCATTGCACAGATGGAAGATGG + Intergenic
985819878 5:2152436-2152458 CTCACTGCACAGATGGAAGATGG + Intergenic
985819881 5:2152471-2152493 CTCACTGCACAGATGGAAGATGG + Intergenic
985819884 5:2152506-2152528 CTCACTGCACAGATGGAAGATGG + Intergenic
985819887 5:2152541-2152563 CTCACTGCACAGATGGAAGATGG + Intergenic
985819890 5:2152576-2152598 CTCACTGCACAGATGGAAGATGG + Intergenic
986370703 5:7077606-7077628 ATTAGGACTCAAATGGAAGAAGG - Intergenic
986374669 5:7117826-7117848 CTGTGTCCTCAGATAGCAGAAGG - Intergenic
986535650 5:8784129-8784151 CTGTGTCCTCACATGGCAGAAGG - Intergenic
987609444 5:20182725-20182747 CTAAGTCCTCAGATGGCAGAAGG - Intronic
987954676 5:24723090-24723112 CAGAGTAGTCATAGGGAAGAAGG - Intergenic
988012001 5:25500854-25500876 CTGAATATTCACATGGCAGAAGG - Intergenic
988288567 5:29254896-29254918 CTGTGTCCTCACATGGCAGAAGG + Intergenic
988673297 5:33405444-33405466 CTGTGTCCTCAGATAGTAGAAGG - Intergenic
988802736 5:34711657-34711679 CTGTGTCCTCATATGGCAGAAGG - Intronic
989112745 5:37922969-37922991 CTGAGAACTCAGAAGGAAGAAGG - Intergenic
989503952 5:42203506-42203528 CTGTGTCCTCACATGGTAGAAGG - Intergenic
989734761 5:44690501-44690523 CTGTGTCCTCACATGGAGGAAGG + Intergenic
990091261 5:52052700-52052722 CTGTGTTCTCACATGGAAGGAGG + Intronic
990559259 5:56967160-56967182 CTGTGTCCTCAAATGGTAGAAGG - Intronic
990697283 5:58434316-58434338 CTGTGTCCTCACATGGTAGAAGG - Intergenic
990806228 5:59665811-59665833 CTGTGTCCTCACTTGGAAGAAGG - Intronic
991514851 5:67424000-67424022 CTGTGTCCTCACATGGCAGAAGG - Intergenic
991689797 5:69214912-69214934 CTGTGTGCTCACATGGCAGAAGG - Intergenic
992085316 5:73273138-73273160 CTGAATCCACAGATGGAGGAGGG - Intergenic
992476280 5:77104509-77104531 TTGAGTCCTCACATGGCAGAAGG - Intergenic
992673673 5:79084211-79084233 CTGTGTCCTCACATGGTAGATGG + Intronic
992747333 5:79832688-79832710 CTGAGTACTCACATGGTGGAGGG + Intergenic
992810439 5:80382409-80382431 CTGTGTTCTCACATGGCAGAAGG + Intergenic
993021904 5:82602114-82602136 CTGTGTCCTCAAATGGCAGAAGG + Intergenic
993023362 5:82618478-82618500 CTGTGTCCTCACATGGCAGAAGG + Intergenic
993164584 5:84335927-84335949 CTGTTTCCTCAGATGGAGGAAGG + Intronic
993453863 5:88105088-88105110 CTGTGTATTCACATGGTAGAAGG - Intergenic
993691281 5:91003830-91003852 CGGTGGACTCAGATGTAAGAAGG + Intronic
994252917 5:97557811-97557833 CTGTGTCCTCACATGGTAGAAGG - Intergenic
994759549 5:103835782-103835804 CTGGGCACTCACATGGCAGAAGG - Intergenic
994810229 5:104507871-104507893 CTGTGTCCTCACATGGTAGAAGG - Intergenic
994993555 5:107030086-107030108 ATGAGTAATGATATGGAAGAAGG + Intergenic
995027347 5:107439226-107439248 CTGAGTCCTCACATGGCAGAAGG - Intronic
995377746 5:111495388-111495410 CTGTGTCCTCATATGGCAGAAGG + Intergenic
995755482 5:115499190-115499212 CTGTGTCCTCACATGGCAGAAGG + Intergenic
996231924 5:121075202-121075224 CTGTGTGCTCACATGGTAGAAGG + Intergenic
996306709 5:122055202-122055224 CTGAGTCCTCACATGGTGGAAGG + Intronic
997385805 5:133471519-133471541 CTGTGTCCTCACATGGCAGAAGG - Intronic
997409368 5:133679448-133679470 CTGAGTCCTCAGATGCTTGAGGG - Intergenic
999097456 5:148992679-148992701 CTGAGACCTCAGGTGGGAGATGG + Intronic
999886680 5:155931954-155931976 CTGTGTGCTCACATGGTAGAAGG + Intronic
999895444 5:156027934-156027956 CTGTATACTCATATGGCAGAAGG + Intronic
1000013605 5:157257446-157257468 CTGTGTTCTCATATGGCAGAAGG - Intergenic
1000966044 5:167658161-167658183 CTGTGTCCTCACATGGCAGATGG + Intronic
1001676522 5:173522262-173522284 CTGCGTTCTCACATGGAAGAGGG - Intergenic
1001814271 5:174654928-174654950 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1001922154 5:175609217-175609239 CTGAGTTCTAGGAGGGAAGATGG + Intergenic
1002592139 5:180298181-180298203 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1002883979 6:1277496-1277518 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1002919584 6:1557406-1557428 CAGTGTACTCAGGTGGAAAATGG - Intergenic
1003601142 6:7518675-7518697 CTGGGTTCCCTGATGGAAGAGGG - Intergenic
1003692060 6:8364731-8364753 CTGTGTCCTCATATGGAAGAAGG - Intergenic
1003692068 6:8364779-8364801 CTGTGTCCTCATATGGAAGAAGG - Intergenic
1003692074 6:8364814-8364836 CTGTGTCCTCATACGGAAGAAGG - Intergenic
1003944912 6:11065939-11065961 CTGAGTTCTCACATGGCAAAAGG - Intergenic
1004021525 6:11780138-11780160 CTGAGTCCTCATGTGGTAGAAGG + Intronic
1004823194 6:19392499-19392521 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1004826314 6:19425321-19425343 CTGTGTCCTCACATGGAAGAAGG + Intergenic
1004971752 6:20918153-20918175 CTGTGTCCTCACATGGCAGAAGG - Intronic
1005446866 6:25932969-25932991 CTGAGTCCTAACATGGCAGAAGG - Intergenic
1006054063 6:31367524-31367546 CTGGGTGCTCAGAGGGAAGATGG + Intergenic
1006330478 6:33386757-33386779 CTGTGTCCTCACATGGTAGAAGG - Intergenic
1007076123 6:39067454-39067476 CTGTGTCCTCACATGGCAGAGGG + Intronic
1007164520 6:39819788-39819810 CTGTGTCCTCACATGGCAGATGG + Intronic
1008560454 6:52719823-52719845 CTGAGTCCTCACATGGTAGAAGG - Intergenic
1008614813 6:53216472-53216494 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1009747580 6:67838508-67838530 CTGTGTCCTCACATGGTAGAGGG + Intergenic
1009882816 6:69590605-69590627 CTGTGTTCTCACATGGCAGAAGG + Intergenic
1010145155 6:72659607-72659629 CTGTGTCCTCACGTGGAAGAAGG + Intronic
1010339580 6:74732555-74732577 CTGGGTCCTCACATGGCAGAAGG - Intergenic
1010473652 6:76261052-76261074 CTGTGTCCTCATATGGCAGAAGG - Intergenic
1010652971 6:78477730-78477752 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1011073264 6:83409063-83409085 CTGTGTCCTCACATGGCAGAAGG - Intronic
1011289938 6:85766374-85766396 CTGGGTCCTCACATGGTAGAAGG + Intergenic
1012065753 6:94549423-94549445 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1012599619 6:101079070-101079092 CTGTGTTCTCACATGGCAGAAGG - Intergenic
1012968079 6:105697101-105697123 CTGCCTAGTCAGATGGAATATGG + Intergenic
1013036829 6:106393197-106393219 CAGAGTTCTGAGATGGAACATGG + Intergenic
1013313766 6:108922077-108922099 CAGAGTACTCTGATGGAGGAAGG + Intronic
1013470034 6:110455841-110455863 CAGTGTCCTCACATGGAAGAAGG - Intronic
1013630016 6:111977254-111977276 CTGTGTCCTCACATGGTAGAAGG - Intergenic
1013675697 6:112459396-112459418 CTGTGTCCTCATATGGTAGAAGG - Intergenic
1013692615 6:112663798-112663820 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1013786708 6:113789441-113789463 CTGTGTCCTCACATGGTAGAAGG + Intergenic
1014688636 6:124533870-124533892 GTGAGGACACAGAGGGAAGATGG - Intronic
1015169893 6:130240768-130240790 CTGAGTCCTCACATGGTGGAAGG - Intronic
1015187088 6:130430212-130430234 CTGTGTCCTCACATGGTAGAAGG + Intronic
1015210110 6:130687242-130687264 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1015330889 6:131977890-131977912 CTGGGGGCTCAGAAGGAAGAGGG - Intergenic
1015389407 6:132664307-132664329 CTGTGTCCTCACATGGTAGAAGG - Intergenic
1015606389 6:134959311-134959333 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1016265397 6:142227390-142227412 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1016388040 6:143548172-143548194 CTGTGTCCTCACATGGCAGAGGG + Intronic
1016807316 6:148224742-148224764 ATGAGTAATGAGATGGGAGATGG + Intergenic
1017192372 6:151668230-151668252 CTGTGTCCTCATATGGCAGAAGG + Intronic
1017341604 6:153330656-153330678 CTGTATGTTCAGATGGAAGATGG + Intergenic
1017459419 6:154635188-154635210 CTGAGTCCTCACATGGTAGAAGG + Intergenic
1017705636 6:157120225-157120247 CTGAGCACCCAGATGACAGATGG - Intronic
1018805141 6:167253462-167253484 CTGTGTCCTCACATGGCAGAGGG + Intergenic
1018805444 6:167255830-167255852 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1019760676 7:2810261-2810283 CTGTGTCCTCAGATGGTGGAAGG + Intronic
1021010558 7:15459373-15459395 GAGAGTTCTCAGATGGCAGATGG + Intronic
1021465439 7:20938001-20938023 CTGAGTCCTCACATGGCAGAAGG + Intergenic
1021477462 7:21078795-21078817 TTGAGTCCTCACATGGCAGAAGG - Intergenic
1021976937 7:26020223-26020245 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1022150292 7:27596222-27596244 CTGTGTCCTCACATGGCAGAAGG + Intronic
1022212470 7:28224970-28224992 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1022407195 7:30101482-30101504 CTGTGTCCTCACATGGAGGAAGG + Intronic
1023539586 7:41251222-41251244 CTGTGTCCTCACATGGTAGAAGG + Intergenic
1023988877 7:45115997-45116019 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1024132021 7:46362773-46362795 CTGTGTCCTCATATGGCAGAAGG - Intergenic
1024325408 7:48105711-48105733 CTGTGTGCTCACATGGCAGAAGG + Intronic
1024961484 7:54981381-54981403 CTGAGTACACAAATGGACAATGG + Intergenic
1024995305 7:55269656-55269678 CTGAGTACACAAATGGACAATGG + Intergenic
1025014407 7:55427312-55427334 CTGGATACTGATATGGAAGATGG + Intronic
1025121481 7:56307644-56307666 CTATGTACTCACATGGCAGAAGG - Intergenic
1025285527 7:57657536-57657558 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1025300616 7:57817236-57817258 CTGTGTCCTCACATGGTAGAAGG - Intergenic
1025887896 7:65615578-65615600 CTGTGTCCTCACATGGCAGATGG + Intergenic
1027569650 7:79847994-79848016 CTGTGTTCTCACATGGCAGAAGG + Intergenic
1027673749 7:81133763-81133785 CTGTGTCCTCACATGGTAGAAGG + Intergenic
1027761459 7:82284606-82284628 CTGAGTCCTCACATGGCAGGAGG + Intronic
1028032657 7:85935549-85935571 CTGACTTCAAAGATGGAAGAAGG - Intergenic
1028423348 7:90658359-90658381 CTGTATACTCAGATGGTAGAAGG + Intronic
1028776839 7:94687284-94687306 CTGTGTCCTCATATGGCAGAAGG + Intergenic
1028906519 7:96160560-96160582 CTGTGTCCTCACATGGAGGAAGG + Intronic
1030203446 7:106929056-106929078 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1030814866 7:114023454-114023476 CTGTGTCCTCAAATGGCAGAAGG + Intronic
1031203447 7:118721863-118721885 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1031624840 7:123980437-123980459 TTGTGTCCTCACATGGAAGAAGG + Intergenic
1031854493 7:126906160-126906182 CTGTGTCCTCACATGGCAGATGG - Intronic
1032275056 7:130447131-130447153 CTGAGTGCTCAAAAGAAAGATGG + Intergenic
1032857190 7:135844809-135844831 CTAAGAACTCAGATTGAAGAAGG - Intergenic
1032932078 7:136684492-136684514 CTGTGTCCTTACATGGAAGAAGG + Intergenic
1033832730 7:145272834-145272856 CTGACTTCTCACATGGCAGAAGG - Intergenic
1033980219 7:147155221-147155243 CTGTGTCCTCACATGGCAGAAGG - Intronic
1034194808 7:149238517-149238539 TTGAGTATTGAGATGGAGGATGG + Intergenic
1034483322 7:151340578-151340600 CTGAGTGCTCAGATCAAAGCAGG - Intergenic
1034716448 7:153247053-153247075 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1035088369 7:156281359-156281381 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1036161794 8:6395872-6395894 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1036180661 8:6581872-6581894 CTGCGTCCTCACATGGCAGAAGG + Intronic
1036566869 8:9945342-9945364 CTGTGTTCTCACATGGCAGAAGG + Intergenic
1036690916 8:10944169-10944191 CTGATGACTCTGATGGAAGCTGG + Intronic
1036773927 8:11597129-11597151 CTGAGTTCTCAGATGCCAGAGGG + Intergenic
1037219082 8:16495350-16495372 CTGAGTACACAGCAAGAAGACGG + Intronic
1037489989 8:19389019-19389041 TTGAGTGCTCAGATGGAGGTGGG + Intronic
1037506272 8:19532680-19532702 ACGAGTACTCAGATGGCAGAAGG + Intronic
1038074848 8:24060547-24060569 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1038103985 8:24412994-24413016 CAGAGTACTCCGTTGGAACAGGG + Intergenic
1038455129 8:27667938-27667960 CTGAGAACCCAGATGGGAGTGGG - Intronic
1038841435 8:31188075-31188097 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1038924665 8:32125111-32125133 CTGTGTTCTCACATGGTAGAAGG - Intronic
1039307173 8:36275254-36275276 CTGAGACCTCACATGGTAGACGG + Intergenic
1039808663 8:41025473-41025495 AGCAGTGCTCAGATGGAAGAAGG - Intergenic
1040021398 8:42744545-42744567 CTGAGTCCTCACATGGTGGACGG + Intergenic
1040350361 8:46560598-46560620 CTGTGTCCTCACATGGTAGAAGG - Intergenic
1040889736 8:52304819-52304841 CTGTGTTCTCACATGGAGGAAGG + Intronic
1041024356 8:53668777-53668799 CTGAGTCCTCACATGGCGGAAGG + Intergenic
1041036793 8:53799807-53799829 CTGTAAACTCAGATGGCAGAGGG - Intronic
1041257623 8:55992785-55992807 CTGTGTCCTCACATGGAAGAAGG + Intronic
1041640872 8:60200130-60200152 CTGTGTCCTCACATGGTAGAAGG - Intronic
1041716933 8:60941015-60941037 CTGTGTTCTCACATGGAAGAAGG + Intergenic
1042076984 8:65007209-65007231 CTGTGTCCTCAGATGGCAGAAGG + Intergenic
1042169553 8:65978341-65978363 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1042936653 8:74066196-74066218 CTGTGTCCTCATATGGCAGAAGG + Intergenic
1043322431 8:79006125-79006147 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1043423312 8:80122811-80122833 TGGAGTACACAGAGGGAAGAAGG + Intronic
1043604016 8:81977356-81977378 CTGTGTCCTCACATGGCAGAGGG - Intergenic
1044348157 8:91130879-91130901 CTGTGTCCTCACATGGTAGAAGG + Intronic
1044510639 8:93074351-93074373 CTGTGTCCTCACATGGTAGAGGG - Intergenic
1045683144 8:104683850-104683872 CTGTGTCCTCACATGGCAGAAGG + Intronic
1045972081 8:108090369-108090391 ATGAGTACTCAAGTGGCAGAAGG - Intergenic
1046152126 8:110241038-110241060 CTGTGTCCTCATATGGTAGAAGG + Intergenic
1046637226 8:116683388-116683410 CTGTGTCCTCAGGTGGCAGAAGG + Intronic
1046954959 8:120053325-120053347 CTGAGATCTGAGATTGAAGAGGG + Intergenic
1047014642 8:120710660-120710682 CTGTGTTCTCACATGGCAGAAGG - Intronic
1047252866 8:123193772-123193794 CTGTGTCCTCACATGGCAGAAGG + Intronic
1047784203 8:128137884-128137906 CTGAGAGCTGAGATGGGAGAGGG + Intergenic
1048142817 8:131811289-131811311 CTGTGTCCTCACATGGTAGAAGG - Intergenic
1048351632 8:133621246-133621268 CTGAGGGCTCAGATGGGAGCAGG - Intergenic
1048894256 8:138975278-138975300 CTGAATACACAGATGGACAATGG - Intergenic
1049367592 8:142248145-142248167 CTGCGTCCTCAGGTGGCAGAAGG - Intronic
1050103936 9:2146187-2146209 CTGTGTCCTCACATGGTAGAAGG + Intronic
1050225983 9:3456044-3456066 CTGTGTCCTCACATGGCAGAAGG + Intronic
1051352041 9:16206085-16206107 CTGAGTCCTCACATGGCGGAAGG + Intronic
1051662684 9:19440501-19440523 CTGTGTCCTCACATGGTAGAAGG - Intronic
1051897267 9:22000577-22000599 CTCAGAACTCAGATGGAATGAGG + Intronic
1051964846 9:22815314-22815336 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1052025316 9:23567527-23567549 GTGACTGCTCAGATGCAAGAGGG - Intergenic
1052044927 9:23782980-23783002 CTGAGCTCTCAAATGGGAGAGGG - Intronic
1052283237 9:26756219-26756241 CTGTGTACTCACATGGAGGAAGG + Intergenic
1052419424 9:28223332-28223354 CTGTGGTCTCACATGGAAGAAGG + Intronic
1052538326 9:29776308-29776330 CTGAATGCTAAGATGGAAGGAGG - Intergenic
1053044248 9:34900837-34900859 CTGTGTCCTCACATGGAAGAAGG - Intergenic
1053793209 9:41701444-41701466 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1054151968 9:61613395-61613417 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1054181618 9:61913456-61913478 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1054471740 9:65544525-65544547 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1054816917 9:69484339-69484361 CTGAGTACCCATATGGAACAGGG + Intronic
1055411385 9:76033770-76033792 CTGTGTCCTCACATGGTAGAAGG + Intronic
1055723749 9:79204908-79204930 CTGTGTCCTCACATGGTAGAAGG - Intergenic
1055753884 9:79536316-79536338 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1056100283 9:83294196-83294218 CTGTGTCCTCACATGGCAGAAGG - Intronic
1056423333 9:86451779-86451801 TTGAGTCCTCAAATGGCAGAAGG + Intergenic
1056423472 9:86453167-86453189 CTGTGTCCTCACATGGTAGAAGG + Intergenic
1057035106 9:91806317-91806339 CTGTGTCCTCACATGGCAGAAGG + Intronic
1057707037 9:97402275-97402297 CTGTGTCCTCAGATGGCAGAAGG + Intergenic
1057871094 9:98718383-98718405 CTGTGTCCTCACATGGTAGAAGG + Intergenic
1057930014 9:99185123-99185145 TTGAGTTCTCAGATGTAGGAAGG - Intergenic
1058188428 9:101883903-101883925 CTGTGTCCTCAAATGGTAGAAGG - Intergenic
1058560844 9:106227269-106227291 CTGTGTCCTCAGATGGTGGAAGG - Intergenic
1058572603 9:106363788-106363810 CTGTGTTCTCACATGGAACAAGG + Intergenic
1058663994 9:107292747-107292769 CTGGCTACTCATATGGGAGATGG - Intronic
1058765344 9:108177359-108177381 CTGTGTTCTCATATGGCAGAAGG + Intergenic
1059599643 9:115762872-115762894 CTGTGTCCTCACATGGTAGAAGG + Intergenic
1059881594 9:118696420-118696442 CTGTGTCCTCAAATGGCAGAGGG + Intergenic
1061249062 9:129415999-129416021 CTGGGGACACAGCTGGAAGATGG + Intergenic
1061272709 9:129552564-129552586 CTGTGTCCTCACATGGAGGAAGG + Intergenic
1061421588 9:130475691-130475713 CTGAGAACTCAGACTGCAGATGG + Intronic
1061530378 9:131207329-131207351 CTGTGATCTCAGCTGGAAGAAGG + Intronic
1062104899 9:134750056-134750078 GTGCCTGCTCAGATGGAAGACGG - Intronic
1185913034 X:4003352-4003374 CTGTGTTCTTAAATGGAAGAAGG - Intergenic
1185938513 X:4286008-4286030 CTGTGTCCTCACATGGAGGAAGG - Intergenic
1185949823 X:4420665-4420687 CTGTGTCCTCACATGGTAGAAGG - Intergenic
1186035919 X:5423541-5423563 CTGAGTCCTCACGTGGTAGAAGG - Intergenic
1186083698 X:5962785-5962807 CTGTGTCCTCACATGGAAAAAGG - Intronic
1186276998 X:7949858-7949880 CTGTGTCCTCACATGGTAGATGG + Intergenic
1186562017 X:10622586-10622608 CTGTGTCCTCACATGGCAGAAGG - Intronic
1186610225 X:11131584-11131606 CTGAGTCCTCACATGGCAGAAGG + Intergenic
1186651976 X:11570981-11571003 CTGTGTCCTCACATGGCAGAAGG - Intronic
1186690110 X:11966338-11966360 CTGCATTCTCACATGGAAGAAGG - Intergenic
1187221761 X:17334095-17334117 CTGTGTACTCAGATGATGGAAGG + Intergenic
1187316712 X:18202522-18202544 CTGTGTCCTCACATGGCAGAAGG - Intronic
1187440508 X:19313758-19313780 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1187609375 X:20924602-20924624 CTGTGTCCTCATATGGCAGAAGG - Intergenic
1187974574 X:24692423-24692445 CTCTGTTCTCACATGGAAGAAGG + Intergenic
1188332126 X:28887247-28887269 CTGAGTTCTCACATGGCGGAAGG - Intronic
1188351816 X:29140777-29140799 CTGAGTCCTCACATGGTGGAAGG + Intronic
1188884080 X:35528454-35528476 CTGCGTCCTCACATGGCAGAAGG - Intergenic
1189274492 X:39775501-39775523 CTGTGTCCTCACATGGTAGAAGG - Intergenic
1189287683 X:39863493-39863515 CTGAGTCCTCACGTGGCAGAAGG + Intergenic
1189311615 X:40022819-40022841 CTGTGAGCTCAGATGGAAAAAGG + Intergenic
1189556263 X:42148452-42148474 CTGTGTTCTCACATGGCAGAAGG + Intergenic
1189560234 X:42184763-42184785 CTGTGTCCTCAGATGGTGGAAGG - Intergenic
1189569759 X:42283940-42283962 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1189916161 X:45857742-45857764 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1190623676 X:52314704-52314726 CTGTGTCCTCACATGGTAGAAGG + Intergenic
1191586711 X:62834726-62834748 GTGAGTTCTCAGATGGAAAGGGG - Intergenic
1192280914 X:69684039-69684061 CTAAGAACTCAGATGAAAAAAGG + Intronic
1192285156 X:69727475-69727497 CTGTGTTCTCACATGGCAGAAGG + Intronic
1193698095 X:84734320-84734342 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1193903418 X:87212763-87212785 CTGTGTCCTCACATGGCAGAAGG + Intergenic
1194289950 X:92059444-92059466 CTGAGTACTCAGAAGCAATATGG - Intronic
1194979097 X:100422489-100422511 CTGTGTATTCACATGGTAGAAGG - Intergenic
1195050662 X:101093873-101093895 CTGTGTCCTCACATGGCAGAAGG + Intronic
1195309771 X:103620791-103620813 CTGTGTACTCACATGGTAGAAGG + Intronic
1196251056 X:113460465-113460487 GTGAGGGCTCAGATGGAAGGGGG - Intergenic
1196286462 X:113886707-113886729 CTGTGTCCTCACATGGAAGAAGG + Intergenic
1196327158 X:114420035-114420057 CTGTGTCCTCACATGGTAGAAGG - Intergenic
1196731560 X:118946085-118946107 CTGTGTCCTCACATGGTAGAAGG - Intergenic
1196974854 X:121148130-121148152 ATGTGTCCTCACATGGAAGAAGG - Intergenic
1197272843 X:124444711-124444733 CTGAGTACTCAGAGGTAGAATGG - Intronic
1198546442 X:137697449-137697471 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1198574044 X:137990599-137990621 CTGTGTTCTCACATGGCAGAAGG + Intergenic
1199736064 X:150687766-150687788 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1199751736 X:150826107-150826129 CTGTGTTCTCACATGGCAGAAGG - Intronic
1199949427 X:152695647-152695669 CTATGTCCTCACATGGAAGAAGG - Intergenic
1199960249 X:152772802-152772824 CTATGTCCTCACATGGAAGAAGG + Intergenic
1200607465 Y:5284019-5284041 CTGAGTACTCAGAAGCAATATGG - Intronic
1200944115 Y:8815267-8815289 CTGGGTCCTCACATGGTAGAAGG + Intergenic
1201446690 Y:14064607-14064629 CTGTGTCCTCACATGGTAGAAGG - Intergenic
1201502700 Y:14662554-14662576 CTGTGTCCTCACATGGTAGAAGG + Intronic
1201676102 Y:16586110-16586132 CTGTGTCCTCACATGGCAGAAGG - Intergenic
1201688193 Y:16731433-16731455 CTGTGTCCTCACATGGTAGAAGG + Intergenic
1201746889 Y:17385952-17385974 CTGAATCCTCAAATGGTAGAAGG - Intergenic