ID: 1090642223

View in Genome Browser
Species Human (GRCh38)
Location 11:128739545-128739567
Sequence CCTTGGGAATGGAGAGTAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 331
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 297}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090642223_1090642240 26 Left 1090642223 11:128739545-128739567 CCCACTACTCTCCATTCCCAAGG 0: 1
1: 0
2: 2
3: 31
4: 297
Right 1090642240 11:128739594-128739616 GAGGGAGGGAGGCAGTGGTGTGG 0: 1
1: 1
2: 32
3: 427
4: 2603
1090642223_1090642234 7 Left 1090642223 11:128739545-128739567 CCCACTACTCTCCATTCCCAAGG 0: 1
1: 0
2: 2
3: 31
4: 297
Right 1090642234 11:128739575-128739597 GCTGAGAGTGGGACAGTGGGAGG 0: 1
1: 0
2: 5
3: 44
4: 513
1090642223_1090642235 8 Left 1090642223 11:128739545-128739567 CCCACTACTCTCCATTCCCAAGG 0: 1
1: 0
2: 2
3: 31
4: 297
Right 1090642235 11:128739576-128739598 CTGAGAGTGGGACAGTGGGAGGG 0: 1
1: 0
2: 6
3: 45
4: 512
1090642223_1090642233 4 Left 1090642223 11:128739545-128739567 CCCACTACTCTCCATTCCCAAGG 0: 1
1: 0
2: 2
3: 31
4: 297
Right 1090642233 11:128739572-128739594 TTGGCTGAGAGTGGGACAGTGGG 0: 1
1: 0
2: 1
3: 28
4: 211
1090642223_1090642232 3 Left 1090642223 11:128739545-128739567 CCCACTACTCTCCATTCCCAAGG 0: 1
1: 0
2: 2
3: 31
4: 297
Right 1090642232 11:128739571-128739593 GTTGGCTGAGAGTGGGACAGTGG 0: 1
1: 0
2: 1
3: 32
4: 322
1090642223_1090642237 12 Left 1090642223 11:128739545-128739567 CCCACTACTCTCCATTCCCAAGG 0: 1
1: 0
2: 2
3: 31
4: 297
Right 1090642237 11:128739580-128739602 GAGTGGGACAGTGGGAGGGAGGG 0: 1
1: 0
2: 21
3: 334
4: 3336
1090642223_1090642231 -4 Left 1090642223 11:128739545-128739567 CCCACTACTCTCCATTCCCAAGG 0: 1
1: 0
2: 2
3: 31
4: 297
Right 1090642231 11:128739564-128739586 AAGGATTGTTGGCTGAGAGTGGG 0: 1
1: 0
2: 0
3: 22
4: 186
1090642223_1090642236 11 Left 1090642223 11:128739545-128739567 CCCACTACTCTCCATTCCCAAGG 0: 1
1: 0
2: 2
3: 31
4: 297
Right 1090642236 11:128739579-128739601 AGAGTGGGACAGTGGGAGGGAGG 0: 1
1: 0
2: 27
3: 318
4: 3152
1090642223_1090642239 21 Left 1090642223 11:128739545-128739567 CCCACTACTCTCCATTCCCAAGG 0: 1
1: 0
2: 2
3: 31
4: 297
Right 1090642239 11:128739589-128739611 AGTGGGAGGGAGGGAGGCAGTGG 0: 1
1: 5
2: 129
3: 1150
4: 4877
1090642223_1090642241 27 Left 1090642223 11:128739545-128739567 CCCACTACTCTCCATTCCCAAGG 0: 1
1: 0
2: 2
3: 31
4: 297
Right 1090642241 11:128739595-128739617 AGGGAGGGAGGCAGTGGTGTGGG 0: 1
1: 0
2: 13
3: 154
4: 1629
1090642223_1090642230 -5 Left 1090642223 11:128739545-128739567 CCCACTACTCTCCATTCCCAAGG 0: 1
1: 0
2: 2
3: 31
4: 297
Right 1090642230 11:128739563-128739585 CAAGGATTGTTGGCTGAGAGTGG 0: 1
1: 0
2: 2
3: 9
4: 229
1090642223_1090642238 15 Left 1090642223 11:128739545-128739567 CCCACTACTCTCCATTCCCAAGG 0: 1
1: 0
2: 2
3: 31
4: 297
Right 1090642238 11:128739583-128739605 TGGGACAGTGGGAGGGAGGGAGG 0: 1
1: 2
2: 52
3: 796
4: 9189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090642223 Original CRISPR CCTTGGGAATGGAGAGTAGT GGG (reversed) Intronic
900988701 1:6087622-6087644 CCTTGAGAAGGGAGAGTGGTCGG + Intronic
901574961 1:10193290-10193312 CTTAGGGAATGGAGAGAAGGGGG + Intergenic
903951066 1:26996210-26996232 GCTTGGGAATGGGGTGAAGTGGG + Intronic
904287156 1:29460196-29460218 CCTTGGGACCTGGGAGTAGTTGG - Intergenic
904439971 1:30523978-30524000 GCTAGGGAATGGAGAGTGTTTGG + Intergenic
904826245 1:33275779-33275801 CCTGGGGGATGGAGATTGGTTGG + Intronic
905291006 1:36921915-36921937 CCTGGGGAAAGGAGAGAGGTGGG - Intronic
905617388 1:39410316-39410338 CCTGGGGAAAGGAGAGGAGGAGG + Intronic
907191843 1:52655930-52655952 CCTTGAGGATGGAGAGAAATGGG + Intronic
907775144 1:57506903-57506925 CAGTGGGAATGGAGAGGAGAGGG - Intronic
909314310 1:74196756-74196778 CAGTGGGAATGGTGAGAAGTTGG - Intronic
909413687 1:75381370-75381392 CCTTGGGAATGGGGAGAAAAAGG + Intronic
909465317 1:75967295-75967317 TCGTGGTAATGGAGAGCAGTGGG - Intergenic
910210121 1:84783651-84783673 CCCCGGGACTGGAGAGTGGTGGG + Intergenic
912130597 1:106595122-106595144 CCTGGGCAATTGAGAATAGTAGG + Intergenic
913075173 1:115336089-115336111 CCTTGGGGCAGGAGAGTTGTGGG + Intronic
913196726 1:116462903-116462925 CCTTGGGAATGGAGAGGCTGGGG - Intergenic
915184763 1:154096075-154096097 CCTCGGGAATGGATAGCATTAGG - Intronic
915239354 1:154508811-154508833 CTTTGGTAATGGGGAGCAGTTGG + Intronic
915401957 1:155628732-155628754 CCTTGGGAATGGGGAGAAAAAGG - Intergenic
915660480 1:157401014-157401036 CCCTGGGAAGGGAGGGCAGTTGG + Intergenic
916784864 1:168079255-168079277 TCTTGGGCATGGTGAGAAGTAGG + Intergenic
917591267 1:176479510-176479532 CCTTGGGAAGGGAGAGGTTTAGG + Intronic
919738803 1:200970385-200970407 CCTTGGGAAGGGACAGCGGTGGG - Intronic
920380006 1:205529685-205529707 CCTTGGGGGTGGAGAGTACAGGG - Intronic
921196599 1:212763174-212763196 CAAAGGGAGTGGAGAGTAGTGGG - Intronic
921354233 1:214270722-214270744 ACTTGAGAATGGAGGGTAGGAGG - Intergenic
922088179 1:222370609-222370631 CCATGGGAAAGGAGAGAAGGAGG + Intergenic
922096571 1:222447949-222447971 CCTTTGGAAGGGAGAGTGGTTGG - Intergenic
924544257 1:245010440-245010462 ACTTGGCAATGGGGAGCAGTGGG + Intronic
1063530481 10:6826244-6826266 CCTTGGGAATGGGGAGAAAAAGG - Intergenic
1065634762 10:27719871-27719893 CCTTGGGCCTCGAGAGTAGCTGG - Intronic
1065846887 10:29751907-29751929 ACGTGGGCATGGAGAATAGTGGG + Intergenic
1066143932 10:32536659-32536681 ACTTGAGAGTGGAGAGTGGTAGG - Intronic
1067627714 10:47937612-47937634 ACTTGAGTATGGAGAGTAGGAGG - Intergenic
1067844768 10:49710868-49710890 CCTGGGGAATGGGGAGAAGGAGG - Intergenic
1069583951 10:69584575-69584597 CAATGGGAATGGAGTGAAGTGGG + Intergenic
1071502205 10:86212083-86212105 CCACGGGGATGGAGAATAGTGGG - Intronic
1072064917 10:91858560-91858582 CCTTGGGAGTGGAGTAGAGTGGG - Intronic
1073988118 10:109232496-109232518 CTTTGGGACTGGAGAGTGGTAGG - Intergenic
1074042551 10:109806122-109806144 ACTTGAGAGTGGAGAGTAGGAGG + Intergenic
1074347949 10:112706601-112706623 CCTTGTGAAAGGATTGTAGTTGG + Intronic
1076429772 10:130393623-130393645 CCATGGGAGTGGAGAGGAATGGG - Intergenic
1076855447 10:133113577-133113599 CCCTGGGAATGGCCAGTAGGAGG + Intronic
1076899720 10:133332190-133332212 CATTGGAAATGGAGAGGTGTGGG + Intronic
1077730614 11:4725324-4725346 CTTTGGGCATGCAGATTAGTAGG - Intronic
1079277987 11:19059525-19059547 CCTTGAGAATGGAATGTGGTTGG - Intronic
1080097250 11:28423713-28423735 GCAGGGGAATGGAGAGTAGTAGG + Intergenic
1080310933 11:30891075-30891097 ACTTGGGAATGTAGAGAAATGGG - Intronic
1081584536 11:44375419-44375441 CCTTGGGTATGGAAAGGGGTGGG + Intergenic
1082702718 11:56453089-56453111 CCTTGAGAATGGAGGGTGGGAGG + Intergenic
1083393182 11:62370546-62370568 CCTTGGGAATGGGGAGAAAAAGG - Intronic
1084591675 11:70094135-70094157 CCCTGGGAGTGGTGAGGAGTGGG - Intronic
1087125152 11:94618258-94618280 CCTTCAGATTGGAGGGTAGTTGG + Intronic
1087724504 11:101702440-101702462 CCTTGGGAATGGGGAGAAAAAGG + Intronic
1088485678 11:110337967-110337989 TCTTGGGAATGCAGCCTAGTAGG + Intergenic
1089322151 11:117633706-117633728 CCTTGGGATTGAAGGGTAGGGGG + Intronic
1089471368 11:118723078-118723100 CCTTGGGAATGGGGAGAAAAAGG - Intergenic
1089844394 11:121447074-121447096 CCCTGGGAATATAGAGGAGTAGG - Intergenic
1090642223 11:128739545-128739567 CCTTGGGAATGGAGAGTAGTGGG - Intronic
1092571836 12:9733907-9733929 CCTGGAAAATGGAGAGTAGATGG + Intergenic
1092636727 12:10459077-10459099 ACTTGAGAGTGGAGAGTGGTGGG - Intergenic
1093017428 12:14169140-14169162 CTTTAGGAAAGGAAAGTAGTTGG - Intergenic
1094151606 12:27290711-27290733 ACGTGGGAATGGAGAGTTGGTGG + Intronic
1095305775 12:40637513-40637535 TCTTGGGAATGCAGACCAGTAGG - Intergenic
1095400918 12:41814056-41814078 GCCTGGGAATGGAGTGTAGAGGG + Intergenic
1096114361 12:49046628-49046650 CCTTGGGGACGGTGAGCAGTGGG + Exonic
1096239730 12:49953425-49953447 CCTTGGGTAAGGAGAGAACTCGG - Intronic
1096720964 12:53521416-53521438 AGTTGGGGGTGGAGAGTAGTTGG - Intronic
1096800204 12:54105637-54105659 CTGTGGGGATGCAGAGTAGTAGG - Intergenic
1096805528 12:54138802-54138824 TCTTGGGAAGGGATAGGAGTGGG + Intergenic
1096921350 12:55089478-55089500 CCTTCGGAAAGCAGAGTAATGGG + Intergenic
1097168641 12:57099577-57099599 CTGTGGGAACGGAGACTAGTGGG - Intronic
1097214241 12:57397549-57397571 CATTAGGAATGTGGAGTAGTTGG + Intronic
1097330673 12:58329525-58329547 CCTTGGGAATGGGGAGAAAAAGG - Intergenic
1098596879 12:72283361-72283383 CCTTGGTAAAGAAGAGCAGTTGG - Intronic
1099262482 12:80400597-80400619 CCTTGGGAAGGGAGAGGAGTGGG - Intergenic
1099406388 12:82268613-82268635 CATAGGGTAGGGAGAGTAGTAGG + Intronic
1100371867 12:93975996-93976018 CCATGGGAATGAAGAGGAGTAGG - Intergenic
1103234033 12:119357375-119357397 TGTTGGGAATGGAGAGAGGTTGG - Intronic
1103389802 12:120563733-120563755 CCTTGGGCATGGGGAGGGGTGGG + Intronic
1103510355 12:121469283-121469305 CTTTGGGAATGGAGTGATGTGGG - Intronic
1104334279 12:127878871-127878893 CTTTGGCAATGGAGAATATTTGG - Intergenic
1104746664 12:131215157-131215179 CCCTGGGAATGGGGATCAGTGGG + Intergenic
1104785896 12:131447757-131447779 CCCTGGGAATGGGGATCAGTGGG - Intergenic
1108973707 13:56409407-56409429 CCATGGAAATAGAGAGTAGAAGG + Intergenic
1110050887 13:70897712-70897734 ACTTGAGAATGGAGGGTAGGAGG - Intergenic
1112494155 13:99892822-99892844 CTGTGGGAATTGAGAGAAGTGGG - Exonic
1112785792 13:102950775-102950797 ACTAGGGAAGGGAGAGTATTAGG - Intergenic
1113452210 13:110419145-110419167 CCTGGGGAATGGAGAGGATATGG + Intronic
1114750131 14:25194790-25194812 TCTAGGGAATAGAGAGAAGTAGG - Intergenic
1116393953 14:44425938-44425960 ACTTGGAAATTGAGAGTAGAAGG + Intergenic
1116577115 14:46588385-46588407 CCTTGGAAATTGAGGGCAGTCGG - Intergenic
1116800187 14:49435537-49435559 ACTTGAGGGTGGAGAGTAGTAGG + Intergenic
1117251480 14:53943798-53943820 TCTTGGTAATGAAGGGTAGTGGG - Intergenic
1117658643 14:57982212-57982234 CTTTGGGAATGCTGAGTTGTCGG + Intergenic
1118217407 14:63822378-63822400 CCTTGGGAATGGAGATTTTCAGG - Intergenic
1119908535 14:78327886-78327908 CCAGGGGAATGTAGAGCAGTTGG + Intronic
1121463069 14:94096936-94096958 CCATGGGAAAGGAGAGTGGATGG + Exonic
1121822757 14:96984617-96984639 CCATGGTAATGGAGAGAAGACGG + Intergenic
1124207112 15:27730521-27730543 CCTTGGGAATGGGGAGGGGTGGG - Intergenic
1124955209 15:34355825-34355847 CCTTGGGTGTGGAGAGGAGAGGG + Exonic
1125241927 15:37585953-37585975 GTTTGGAGATGGAGAGTAGTGGG - Intergenic
1125713642 15:41806454-41806476 TCTGGGGGATGGAGAGTGGTAGG + Intronic
1128931285 15:71706930-71706952 CCTGGAGGATGGAGAGGAGTTGG + Intronic
1128976393 15:72156746-72156768 CCCTGGGAATAGTGAGGAGTGGG + Intergenic
1130130199 15:81134530-81134552 CCTTGGGAGTTTAGAGAAGTGGG - Intronic
1130938139 15:88487445-88487467 CAGTGGGGATGGAGAGAAGTTGG + Intergenic
1131501862 15:92975523-92975545 CCATGGGATTTGAGAGAAGTGGG + Intronic
1132144638 15:99421774-99421796 CCTTGAGAGTGGAGAGTGGGAGG - Intergenic
1133486582 16:6225366-6225388 CCTTGGGAACAGAGAGAACTTGG + Intronic
1136070672 16:27785141-27785163 CCCCGGGAATGGAGGGAAGTGGG - Intergenic
1136930520 16:34414115-34414137 CCTTGGGAATGGGGAGAAAAAGG - Intergenic
1136974054 16:34997693-34997715 CCTTGGGAATGGGGAGAAAAAGG + Intergenic
1138258868 16:55598628-55598650 ACTTGGGCATGGAGTGTGGTAGG + Intergenic
1140528205 16:75641475-75641497 CTTTGGGACTGGACAGTAGGAGG - Intronic
1141295267 16:82762174-82762196 CTTTGGGAAGAGAGAGTAGCAGG - Intronic
1141954941 16:87364460-87364482 CCTCTGGAATGGAGAAGAGTCGG - Intronic
1141971817 16:87489665-87489687 CCTTGGGACTGGGGTGTAGCGGG + Intronic
1142067584 16:88071614-88071636 CCTTGGGAATGGGGAGGGTTTGG + Intronic
1142186042 16:88695176-88695198 CCTGGGGAAGGGAGAGGAGCCGG - Intergenic
1142591723 17:1009220-1009242 AGTGGGGAATGGACAGTAGTGGG - Intronic
1143506781 17:7370520-7370542 CCTTGGGAATGCAAAGAAGTGGG - Intergenic
1146801209 17:35824604-35824626 CCTTGGGAAGGGAAAGTATTAGG + Intronic
1148695515 17:49555956-49555978 TCTTGGGAGTGGAGAATAGCTGG - Intergenic
1148856593 17:50582350-50582372 CCCTGGAAATGGAGAGCAGAGGG + Intronic
1149149075 17:53537271-53537293 CCCTGGGTATGGAGAGTAATGGG + Intergenic
1149988707 17:61368232-61368254 CCCTGGGTATGGAGAGGAGCGGG + Intronic
1150847538 17:68675022-68675044 CCCTGGTAATGGAAGGTAGTGGG - Intergenic
1151203199 17:72484101-72484123 ACATGGGAAGAGAGAGTAGTGGG + Intergenic
1151815108 17:76467974-76467996 CCTGGGGAATGGGGAGGAGCAGG - Intronic
1152121224 17:78419945-78419967 CCCTGGGAAGGGAGAGCAGAAGG - Intronic
1152975494 18:213494-213516 CTTTGAGAAGGGAGAGGAGTAGG + Exonic
1153591056 18:6674530-6674552 CCCTGGGGATGGAGAGTGGTGGG + Intergenic
1155662342 18:28264549-28264571 GCTGGGGGAGGGAGAGTAGTAGG - Intergenic
1155803939 18:30142597-30142619 CCTTGGAAATTGAGGGCAGTTGG - Intergenic
1157193999 18:45605604-45605626 CCTTGAAACTGGAGAGAAGTGGG + Intronic
1158224134 18:55182889-55182911 CTTGGGGAATGGAGAGTGGGAGG - Intergenic
1158858255 18:61565744-61565766 GCTTGGGGTTGGAGAGGAGTAGG - Intergenic
1158987627 18:62834875-62834897 TCTTAGGGATGGAGAGGAGTGGG - Intronic
1159103575 18:63981174-63981196 CCATGGGAATGGAGCGTGATAGG - Intronic
1161198485 19:3000723-3000745 CCTTGGGGAAGGAGAGCAGCAGG + Exonic
1164370510 19:27639683-27639705 CCTTGGGAATGGGGAGAAAAAGG - Intergenic
1165015851 19:32879545-32879567 CCCTGGGAATGGGGAGCAGCAGG + Intronic
1165015868 19:32879610-32879632 CCCTGGGAATGGGGAGCAGCAGG + Intronic
1165423087 19:35732073-35732095 CCTCCGGGATGGCGAGTAGTTGG - Exonic
1165606402 19:37108695-37108717 CCTTGGGAATGGGGAGAAAAAGG - Intronic
1166632970 19:44424055-44424077 GCTTGAGAATGAAGAGTTGTAGG - Intronic
1168148511 19:54432585-54432607 CATTGGGCATTGAGAGTAGATGG - Intronic
1168470747 19:56638760-56638782 CAATGGGGATGGAGAGCAGTGGG - Intergenic
926004470 2:9362272-9362294 CCTTGTGAAAGGAGAGTGGTGGG + Intronic
926020286 2:9488797-9488819 CCTTGGAAATGGGGGGTAGGAGG + Exonic
926105800 2:10150015-10150037 CATTGGAAATGGAGTGTAGCTGG + Intronic
926290233 2:11523224-11523246 ACTTGAGAATGGAGAGTGGGAGG + Intergenic
926585119 2:14677221-14677243 CCTTGGGAATTTAGGGTGGTGGG - Intergenic
929832332 2:45357157-45357179 CATGGGGAAGGGAGAGTAGATGG - Intergenic
930310184 2:49730786-49730808 TGTTGGGAGTGGAGACTAGTGGG - Intergenic
932326301 2:70864267-70864289 CCATGTGGATGGAGAGAAGTAGG - Intergenic
932575517 2:72960423-72960445 CAGTGGGCATGGAGAGAAGTGGG - Intronic
933194452 2:79372410-79372432 CCTTGGGAATGGAGAAGACCTGG - Intronic
933327371 2:80855338-80855360 CCTTGGGATGGGAGTGCAGTGGG - Intergenic
933463074 2:82613805-82613827 CCTAGGTAAAGAAGAGTAGTAGG + Intergenic
935160357 2:100524343-100524365 CCTTGGGAGTCTAGAGAAGTTGG + Intergenic
935945422 2:108281753-108281775 CCTGGTGAATGTAGAGTAGTGGG - Intergenic
939329731 2:140741630-140741652 ACTTGAGAATGGAGAGTGGTAGG - Intronic
940839710 2:158565952-158565974 CCTTGGGAATGCTGGGTAGCTGG - Intronic
940984052 2:160035359-160035381 CCTTGGGAAGGGAGAGTGAAAGG - Intronic
943996744 2:194777316-194777338 TCATGGGAATAGAGAGTAGAAGG + Intergenic
944302992 2:198145910-198145932 CCATGAGAATGGAGAGGAGAGGG + Intronic
944996185 2:205296722-205296744 TTTTGGGAATGGAGGGTAGTAGG + Intronic
945636024 2:212352162-212352184 CCTTGAAAATGGAGGGTAGGAGG + Intronic
945689153 2:213010689-213010711 CTTTGGTAATGGAGAGAACTAGG + Intronic
945989873 2:216386823-216386845 CCTTGGGATTTGAGAGCAGTAGG + Intergenic
946918395 2:224550978-224551000 ACTTGGTAATGGAGAGGAATGGG - Intronic
948315682 2:237026812-237026834 CATTGGGAATGGAGACCAGGTGG + Intergenic
948987462 2:241534034-241534056 CCTTGGGAAGGGAGGGTCTTTGG + Intergenic
1170025659 20:11886887-11886909 CCTTGGGTATGGGGAGTAACAGG + Intergenic
1170906058 20:20516064-20516086 CAATGGGAGTGGAGAGTAGCAGG - Intronic
1170921891 20:20686985-20687007 GCTTGGGAATGGAGGGGTGTAGG - Intronic
1172166677 20:32903811-32903833 CCATGGGAGTGGAGGGAAGTAGG + Intronic
1172789318 20:37491600-37491622 CCTTGGGAATGAGGAGCAGCAGG - Intergenic
1173038498 20:39436070-39436092 TCGTGGGCATGGAGAGTAGAAGG - Intergenic
1175057497 20:56211520-56211542 CCCTGGCAATGGAAAGTGGTTGG - Intergenic
1177807307 21:25886827-25886849 CGTTGGCATTGTAGAGTAGTTGG - Intronic
1177996175 21:28101898-28101920 CTTTGGGAGTGGAAAGTAATGGG - Intergenic
1179367147 21:40769112-40769134 CCTTGGGAAGTGAGAGCAGAGGG - Intronic
1179767595 21:43584701-43584723 CCTTTGGCATTGAGTGTAGTGGG - Intronic
1180838489 22:18945764-18945786 CCTTGGGAATGGGGAGAAAAAGG + Intergenic
1181882875 22:25995249-25995271 CCATGGGAATAGACAGTAGGAGG + Intronic
949501465 3:4684095-4684117 CCTTGGGAAGGGATAGTAGTGGG - Intronic
949919529 3:8990331-8990353 CCGTGGGAGTGGAGACTGGTTGG - Intronic
950575875 3:13831819-13831841 CCCTGGGCATCGAGAGAAGTTGG - Intronic
950863220 3:16168876-16168898 CCTTGGGTATGGAGAGCAGGTGG + Intergenic
950969982 3:17176661-17176683 GCTAGGGAAGGGAGAGTATTAGG + Intronic
951543474 3:23805552-23805574 CTTTTGGAAAGGAGAGGAGTAGG - Intergenic
951622177 3:24614715-24614737 TCTTGGGGATGGACAGTATTGGG - Intergenic
953125749 3:40090341-40090363 CCTTGGAATTGGAGAGCATTAGG + Intronic
955500409 3:59577645-59577667 CCTTGGGAATTGAGACTTTTGGG - Intergenic
959016250 3:101137079-101137101 TTTGGGGAATGGTGAGTAGTTGG - Intergenic
959070626 3:101698930-101698952 CCTTGGGAATGGGGAGAAAAAGG + Intergenic
959115255 3:102169977-102169999 CCACAGGAATGGAGAGTAGTGGG - Intronic
960027586 3:113026336-113026358 CCTTGGGAATGGGGAGAAAAAGG - Intergenic
960951113 3:122999095-122999117 CCTTAGGAATGTGGTGTAGTGGG - Intronic
964141910 3:153412505-153412527 ACTTGAGAATGGAGAGTGGGAGG - Intergenic
966714960 3:183005664-183005686 CATGGGGCATGGAAAGTAGTTGG + Intergenic
967026016 3:185564614-185564636 CCTTGGGAATGGGGAGAAAAAGG - Intergenic
968743379 4:2342839-2342861 CAATGGGAAAGGAGAGAAGTGGG + Intronic
969554499 4:7897048-7897070 CCTTGGGAGTGGATAGAATTAGG - Intronic
971033771 4:22670141-22670163 AGCTGGGAATGGTGAGTAGTGGG + Intergenic
971103013 4:23489317-23489339 CCTTGAGAATGGAGTATAGGTGG - Intergenic
973016440 4:45144757-45144779 TCTTGGAAATGGAGAGTGATGGG + Intergenic
974633720 4:64530513-64530535 TCCTGGGAATGCAGACTAGTAGG + Intergenic
974856223 4:67465115-67465137 CATAGGGAATGGGGAGTAGCAGG - Intergenic
975226111 4:71874623-71874645 AGTTGGGAATGGAGAGAGGTTGG - Intergenic
975503213 4:75110118-75110140 CCTTGGGAAAGCACAGTATTTGG - Intergenic
978693793 4:111550443-111550465 ACTTGAGGATGGAGAGTAGGAGG + Intergenic
980325558 4:131340561-131340583 ACTTGGGAATGTAGAGTATTGGG - Intergenic
980953284 4:139402927-139402949 ACATGGAAATGGAGAGAAGTTGG - Intronic
981863431 4:149384456-149384478 TCTTGTCACTGGAGAGTAGTTGG + Intergenic
983215741 4:165000819-165000841 CCTTGGGAATGGGGAGAAGAAGG + Intergenic
983991871 4:174129681-174129703 TAGTGGGAATGGAGAGAAGTGGG - Intergenic
985752514 5:1688962-1688984 CATTGGGTCTGGAGAGTGGTCGG + Intergenic
986774440 5:11001012-11001034 CCTTGGGAATGGAGACTGAAGGG - Intronic
987520839 5:18981400-18981422 ACTTGAGGATGGAGGGTAGTGGG - Intergenic
987983043 5:25113196-25113218 ACTTGAGAGTGGAGAGTAGAAGG + Intergenic
988380140 5:30488711-30488733 CCTTGGGAATGGGGAGAAAAAGG - Intergenic
989125536 5:38049097-38049119 CCTTGGGTATGCAGGGGAGTGGG + Intergenic
989436457 5:41418913-41418935 CCTTGTAAATGGAAAGCAGTAGG + Intronic
991662256 5:68962197-68962219 CAATGAGAATGGAGAGAAGTAGG + Intergenic
992525403 5:77605306-77605328 CCTTGGGCATGTGGAGTGGTAGG - Intronic
995441775 5:112200162-112200184 CATTGGGAATGGAAAGAAGCAGG - Intronic
997221388 5:132168842-132168864 GTCTGGGAATGGAGAGTAGTTGG - Intergenic
997575836 5:134976576-134976598 TCTTGGGTCTGGAGAGCAGTGGG + Intronic
997949552 5:138231277-138231299 CCCTGGGAATTGGGAGGAGTGGG - Intergenic
998895433 5:146794079-146794101 CTTTGGGAATGGAGAGTTATTGG - Intronic
999951862 5:156659772-156659794 CCTTGGGAATGGGGAGAAAAAGG - Intronic
1000825772 5:166042081-166042103 CCTTAGGATTGCAGAGTAGCAGG + Intergenic
1001084199 5:168688438-168688460 CTTTAGGAATGGATAGAAGTGGG + Intronic
1004305332 6:14496940-14496962 CCTTAGTAATGGAGAATAATTGG - Intergenic
1005805963 6:29474786-29474808 CCATGGGAATTGAGAATAATGGG + Intergenic
1006312884 6:33273506-33273528 GTTAGGGAATGGATAGTAGTAGG + Intronic
1007327979 6:41077400-41077422 CCTTGGGAGTGGAGAATACAGGG - Intronic
1007371716 6:41430491-41430513 CCATGGGAATGGGGAGTGGGAGG + Intergenic
1007552126 6:42738242-42738264 CCATGGAAATAGAGAGTAGAAGG + Intergenic
1009789782 6:68386542-68386564 CCCTGGGAATGGAGACGATTAGG - Intergenic
1010306449 6:74328765-74328787 CAATGGGAATGAAGAGAAGTTGG - Intergenic
1010591615 6:77719003-77719025 CCTTGGGAATGGGGAGAAAAAGG - Intronic
1010625374 6:78131761-78131783 CCTTGGGAAAAGAGAGGAGTGGG + Intergenic
1011611947 6:89160924-89160946 GCTAGGGCATCGAGAGTAGTGGG + Intronic
1011957141 6:93037384-93037406 GCTTGGGCATGGAGTGTAGAGGG + Intergenic
1012171075 6:96016641-96016663 CTTTGGGAAAGGAGAGAAGGTGG - Intronic
1013332567 6:109119456-109119478 ACTTGAGAATGGGGAGTAGGAGG + Intronic
1014376477 6:120681087-120681109 CTCTGGCAATGGAGAGTGGTTGG + Intergenic
1015143359 6:129959198-129959220 CCTTGGCTATGGAGAGGAGCGGG + Intergenic
1016052264 6:139542410-139542432 ACTTAGGGATGAAGAGTAGTTGG - Intergenic
1016170918 6:141015551-141015573 CCTTGGGCATGGAGAGGAATAGG + Intergenic
1016221496 6:141676803-141676825 CATTGGGAATGGAACCTAGTTGG + Intergenic
1016555067 6:145327268-145327290 CCCTTGGAATTGAGAGTAGACGG + Intergenic
1018012365 6:159683096-159683118 CTTTGGGAATACAGAGCAGTTGG + Intronic
1018027444 6:159817220-159817242 CCCTGGGACTGGAGAGGTGTTGG - Intronic
1018651845 6:165998908-165998930 CACTGGGAATGGAGAGAAGGAGG - Intergenic
1019254584 7:41106-41128 CTTAGGGAATGGGGAGCAGTGGG - Intergenic
1019976289 7:4584492-4584514 CCTTGGGAATGGGGAGAAAAAGG - Intergenic
1019977225 7:4592996-4593018 CCTTGGGAATGGGGAGAAAAAGG - Intergenic
1021558070 7:21941913-21941935 CCTTGGGTTTGGAGAGTAGAGGG - Intronic
1021586713 7:22216389-22216411 CCTAGGGAATGGAGAGGGGTGGG - Intronic
1021622435 7:22562117-22562139 CCGAGGGTATGGAGAGTTGTTGG + Intronic
1023766584 7:43517358-43517380 GCTTGGGAAGGGAGAGAGGTCGG - Intronic
1023895038 7:44426279-44426301 CCTGGGGAAAGGAGAATGGTTGG + Intronic
1024369740 7:48567455-48567477 CATTGAGATTGGGGAGTAGTTGG + Intronic
1026432047 7:70357267-70357289 CCTTGGGAAGGCAGAGGAGCTGG - Intronic
1026542326 7:71290475-71290497 CCTTGGGGAGGGAGAATAGATGG + Intronic
1027739233 7:81978904-81978926 ACTTGAGAAGGGAGAGTATTTGG - Intronic
1029839588 7:103347835-103347857 CCTTGGCACTGGAGAGGAGCTGG + Intronic
1030287181 7:107838600-107838622 CCTTGGGATTGGAGACAAGACGG + Intergenic
1031349873 7:120717795-120717817 CCTTGGGAATTGAGTGTACTTGG - Intronic
1032285947 7:130538554-130538576 CCTTAGGAAAGGAAAGTAGGGGG + Intronic
1032338653 7:131050071-131050093 CTTTGGGAATGCAGCCTAGTAGG + Intergenic
1032538581 7:132684933-132684955 CCTGGGGAAGGGAGAGGTGTGGG + Intronic
1036134519 8:6148019-6148041 CCTTGGGAAAGGAGAGGGGTTGG + Intergenic
1037137913 8:15485672-15485694 TGTTGGGAATGAAGAGTAGGAGG + Intronic
1037381778 8:18292832-18292854 CCTTGGGAATACAGAGAAATTGG + Intergenic
1038135087 8:24776790-24776812 CCTAGAGAATTGAGAATAGTAGG + Intergenic
1039865245 8:41495235-41495257 TCTTGGGAATAGTGAATAGTAGG + Intronic
1039906397 8:41789609-41789631 CATTGGGACTGAAGACTAGTGGG + Intronic
1040317643 8:46273359-46273381 TCCTGGGATGGGAGAGTAGTAGG - Intergenic
1041544594 8:59027870-59027892 CCATGTGAATGAAGAGCAGTAGG - Intronic
1044839457 8:96325588-96325610 CAGTGGGAATGGAGAGGAGATGG - Intronic
1044944629 8:97378941-97378963 GCCTGGGAATGGATAGGAGTGGG + Intergenic
1046215941 8:111147116-111147138 CCTTGAGAGGGGAGAGTAATGGG - Intergenic
1046581138 8:116093805-116093827 CCTTTGGAATTGAGAGTACAAGG - Intergenic
1047428022 8:124764433-124764455 CCTTGGGAAGGGACAGTTGGAGG + Intergenic
1047870995 8:129081824-129081846 CTTTGGGAATGGACAGTAGGTGG + Intergenic
1049069979 8:140349033-140349055 CCTTGGCAAGGGAGAGGAGAGGG + Intronic
1050278876 9:4029633-4029655 CCATGGAAATGGAGAATAGAAGG - Intronic
1050459978 9:5869406-5869428 CCTTGGGAATGAGGAGGAGAAGG + Intergenic
1051800488 9:20927692-20927714 CCTAGGCAATGGATAGTAATAGG - Intronic
1052135819 9:24908618-24908640 CCTTGGATATGGAGGGCAGTGGG + Intergenic
1053649762 9:40154904-40154926 TCTTGGAAATGGAGAGTCATGGG - Intergenic
1053755986 9:41309043-41309065 TCTTGGAAATGGAGAGTCATGGG + Intergenic
1054330272 9:63746666-63746688 TCTTGGAAATGGAGAGTCATGGG - Intergenic
1054534819 9:66221300-66221322 TCTTGGAAATGGAGAGTCATGGG + Intergenic
1055149341 9:72976585-72976607 GCTAGGGAAGGGAGAGTATTAGG + Intronic
1056932791 9:90892726-90892748 CCTTGCAAATGGAGAGAAGTTGG + Intronic
1058462358 9:105195008-105195030 CGTTGGGAATGGAGTGTTGTTGG - Intergenic
1059093264 9:111384482-111384504 CATTGGGAATGGAGTGGAGCAGG - Intronic
1059958398 9:119541996-119542018 CCTTGGGATTGGAGATGGGTAGG + Intergenic
1060327314 9:122629670-122629692 CCTTAGGGAGGGAGAGTAGATGG - Intergenic
1060884359 9:127140154-127140176 CCTTGGTAAAGAAGAGGAGTTGG - Intronic
1061330740 9:129890643-129890665 CCCTGGGAGGGGAGGGTAGTGGG + Intronic
1062287014 9:135777840-135777862 AGCTGGGAATGGAGAGTAGCTGG - Intronic
1062599251 9:137312587-137312609 CCTTGGGCCTGGAGAGGAGAGGG - Intronic
1202797651 9_KI270719v1_random:139550-139572 TCTTGGAAATGGAGAGTCATGGG - Intergenic
1186030373 X:5362484-5362506 TCTTGAGAAAGGAGAGGAGTGGG - Intergenic
1188467382 X:30497396-30497418 CCTTTGGAATGGAGATAAATGGG + Intergenic
1189731253 X:44023169-44023191 CCTTGGGGATGGAAAGTCTTTGG - Intergenic
1190809607 X:53870510-53870532 CCTTGAGGATGGAGAGTGGGAGG - Intergenic
1191007210 X:55722362-55722384 CCTTGGGGATGCAGAGAGGTTGG + Intronic
1192406406 X:70890499-70890521 CGTTGGAAAAGCAGAGTAGTTGG - Intronic
1193160582 X:78224603-78224625 ACTTGAGGATGGAGAGTAGCAGG + Intergenic
1193512596 X:82422997-82423019 ACTTGAGAATGGAGAGTGGAAGG + Intergenic
1193583670 X:83294608-83294630 GCATGGGCATGGTGAGTAGTAGG - Intergenic
1195079759 X:101359529-101359551 TCATGGAAATGGAGAGTAGCAGG + Intronic
1195743707 X:108092080-108092102 CCTAGGGAGTGGAAAGAAGTGGG + Intronic
1196968436 X:121083641-121083663 CCTTGGAAATTGAGAGCAATTGG - Intergenic
1197408916 X:126091921-126091943 TCATGGAAATGGAGAGTAGAAGG + Intergenic
1198276148 X:135097741-135097763 CCTGGGGAATGGAAGGTAGTGGG - Intergenic
1198310366 X:135423000-135423022 CCTGAGGAATGGAGGGTAATGGG + Intergenic
1200760783 Y:7036881-7036903 CTTTGGAAAAGGAGAGCAGTAGG + Intronic
1202351346 Y:23995640-23995662 CCTTGGGAATGGAGAATTAGGGG - Intergenic
1202519433 Y:25674479-25674501 CCTTGGGAATGGAGAATTAGGGG + Intergenic