ID: 1090643574

View in Genome Browser
Species Human (GRCh38)
Location 11:128749373-128749395
Sequence CTGGAGGTTGACGCTGTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 421
Summary {0: 1, 1: 0, 2: 3, 3: 38, 4: 379}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090643570_1090643574 7 Left 1090643570 11:128749343-128749365 CCTTCACTGAAGGCTCGTTCACT 0: 1
1: 0
2: 0
3: 5
4: 73
Right 1090643574 11:128749373-128749395 CTGGAGGTTGACGCTGTGGTTGG 0: 1
1: 0
2: 3
3: 38
4: 379

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090643574 Original CRISPR CTGGAGGTTGACGCTGTGGT TGG Intronic
900171607 1:1271898-1271920 CAGGAGGTGGAGGCTGTGGTGGG + Intronic
900373995 1:2345052-2345074 CTGGAGGCTGACACTGTCTTCGG - Intronic
900495300 1:2973399-2973421 CCGGAGGATGAGGCTGTGCTGGG + Intergenic
900557613 1:3288190-3288212 CTGGAGGCTGTGGCTGTGGAAGG + Intronic
900795917 1:4708350-4708372 CTGATGGTTGGTGCTGTGGTCGG + Intronic
901100906 1:6717755-6717777 CTGGAGGTTGAGGCTACAGTGGG + Intergenic
901371416 1:8801184-8801206 CAGGAGGTTGAGGCTGCAGTCGG + Intronic
901505387 1:9682004-9682026 CAGGAGGTTGAAGCTGCAGTTGG - Intronic
901580764 1:10241183-10241205 CAGGAGGTTGAGGCTGCAGTGGG - Intronic
901867826 1:12118936-12118958 CGGGAGGTGGAGGTTGTGGTGGG - Intronic
902432430 1:16373707-16373729 CGGGAGGTTGAGGCTGAAGTGGG - Intronic
902667445 1:17949400-17949422 TTGGAGGATGAGGCTGTGGAGGG + Intergenic
902856478 1:19210034-19210056 CTGGCGGGCGACGCTGTTGTGGG - Intronic
902903727 1:19538745-19538767 CAGGAAGTTGACGCTGCAGTGGG - Intergenic
903383494 1:22912434-22912456 CGGCAGGTTGATGCTGGGGTTGG - Exonic
903688030 1:25146764-25146786 CTGGAGCAGGACCCTGTGGTTGG - Intergenic
903714385 1:25353354-25353376 CAGGAGGTTGAGGCTGCAGTGGG - Intronic
904200476 1:28816244-28816266 CTGAAGTTTGTAGCTGTGGTAGG + Intronic
906626646 1:47331413-47331435 CAGGAGGTGGAGGCTGAGGTGGG - Intergenic
907051787 1:51334579-51334601 CAGGAGGTTGAGGCTGCAGTGGG + Intronic
908136030 1:61133757-61133779 CAGGAGTTTGAGGCTGTAGTGGG + Intronic
909212177 1:72837966-72837988 CTGAAAGTTGACACTGTGGCTGG + Intergenic
912371893 1:109179991-109180013 CTGGAGGCAGAGGCTGTGGTAGG + Intronic
913199067 1:116481784-116481806 CTGGGAGTTGATGCTGTGTTGGG - Intergenic
914312275 1:146477304-146477326 CAGAAGTTTGAGGCTGTGGTGGG + Intergenic
914502074 1:148256032-148256054 CAGAAGTTTGAGGCTGTGGTGGG - Intergenic
914846207 1:151284881-151284903 CGGGAGGTCGAGGCTGTGATGGG - Intronic
914887173 1:151594893-151594915 CAGGAGGTTGAGGCTGCAGTGGG + Intergenic
915004373 1:152623022-152623044 CTGGAGGCAGACACTGTGCTGGG + Exonic
915613031 1:157010493-157010515 CAGGAGTTTGAAGCTGTAGTGGG - Intronic
916242003 1:162649604-162649626 CTGGTGGTGGAGGCAGTGGTAGG + Intronic
916892596 1:169126635-169126657 CAGGAGGTTGAGGCTGCAGTGGG + Intronic
917760206 1:178148520-178148542 CAGGAGGTTGAAGCTGCAGTGGG - Intronic
917923636 1:179771195-179771217 CTGGGGGCTGAAGCTGTGGACGG - Intronic
918476979 1:184935432-184935454 CAGGAGGTTGAGGCTGCAGTGGG + Intronic
921079908 1:211730810-211730832 CAGGAGGTTGAGGCTGCAGTAGG + Intergenic
922229095 1:223670195-223670217 CAGGAGGTTGAGGCTGCCGTGGG + Intergenic
922501866 1:226103214-226103236 CAGGAGTTTGAAGCTGTAGTGGG - Intergenic
923664755 1:235990241-235990263 CTGGAGGTTGGTCCTGTGGCAGG + Intronic
924213996 1:241800571-241800593 CAGGAGGTTGAGGCTGCAGTGGG + Intronic
924407170 1:243760191-243760213 CAGGAGGTTGAGGCTGCAGTGGG - Intronic
1063211431 10:3884570-3884592 TTGGAGGTGGAAGATGTGGTTGG - Intergenic
1063663284 10:8048201-8048223 CTGGGGGTTGGGGCTGTGGTTGG + Intergenic
1064250799 10:13704960-13704982 CGGGAGGCTGAGGCTGAGGTGGG + Intronic
1064362022 10:14674806-14674828 CGGGAGGTTGAAGCTGCAGTGGG - Intronic
1064500665 10:15969413-15969435 CAGGAGGTCGACCCTGCGGTAGG + Intergenic
1065220067 10:23487411-23487433 CAGGAGTTTGAGGCTGCGGTGGG + Intergenic
1065275964 10:24085897-24085919 GAGGAGGTTGAGGCTGCGGTGGG + Intronic
1066079743 10:31918630-31918652 CTGGAAGTTGAGGCTGCAGTGGG + Intronic
1066394010 10:35001435-35001457 CTGGAGGCTGAGGCTGAGGCAGG + Intergenic
1067375659 10:45726178-45726200 CTGGAGTTCCACGGTGTGGTGGG - Intergenic
1067883371 10:50066867-50066889 CTGGAGTTCCACGGTGTGGTGGG - Intergenic
1067902665 10:50258395-50258417 CTGGAGGCTGACACAGGGGTTGG + Intergenic
1068145729 10:53067914-53067936 CAGGAGGTAGAGGCTGTAGTGGG + Intergenic
1070185834 10:74061969-74061991 CAGGAGGTTGAGGCTGCAGTGGG - Intronic
1070229301 10:74547730-74547752 CAGGAGGTGGAGGTTGTGGTGGG - Intronic
1070282561 10:75060362-75060384 CAGGAGGCTGAGGCTGAGGTGGG + Intergenic
1070344239 10:75526137-75526159 CAGGAGGTTGAGGCTGCAGTGGG - Intronic
1072014531 10:91333837-91333859 CAGGAGTTTGAGGCTGTAGTGGG + Intergenic
1072892568 10:99337396-99337418 CTGGAGGGTAAAGCTGTGGCAGG - Intronic
1073546022 10:104349661-104349683 CTGTAGTTTGACGGTGTGGTAGG + Intergenic
1073657453 10:105432106-105432128 CAGGAGGTTGAGGCTGCAGTGGG - Intergenic
1074837920 10:117316575-117316597 CGGGAGGTGGAAGCTGAGGTGGG + Intronic
1076249298 10:128972604-128972626 CAGGAGGTTGGGGCTGGGGTGGG + Intergenic
1076614620 10:131747388-131747410 CTGGAGGATGCCGCTGAGGGCGG - Intergenic
1076691713 10:132227063-132227085 CTGGTGGCTGATGCTGGGGTGGG - Intronic
1076991026 11:274332-274354 CTAGAGATTGAGGCTGTTGTAGG - Intergenic
1077187535 11:1242035-1242057 CTGGAGGTTGCCATTGTTGTTGG - Exonic
1077653430 11:3995716-3995738 CAGGAGGTTGAGGCTGCAGTGGG - Intronic
1079170497 11:18089972-18089994 CAGGAGTTTGAGGCTGTAGTAGG + Intronic
1080358038 11:31474609-31474631 CAGGAGGTTAAGGCTGAGGTGGG + Intronic
1080528542 11:33151262-33151284 CAGGAGGTTGAGGCTGCAGTGGG - Intronic
1080888436 11:36387790-36387812 CTGGAGGCTGTAGCTGTGATGGG + Intronic
1081903978 11:46654646-46654668 CAGGAGGTTGAGGCTGCAGTGGG + Intronic
1082074404 11:47965148-47965170 CAGGAGGTTGAGGCTGCAGTGGG - Intergenic
1084170241 11:67397394-67397416 CTGGAGGTGGAGGCAGGGGTGGG + Intronic
1084351478 11:68603076-68603098 ATGGAGGTGGACGCTGAGCTGGG + Intronic
1088241307 11:107776092-107776114 CAGGAGGTGGAGGTTGTGGTGGG + Intergenic
1088352514 11:108905989-108906011 CTGGAGGTGGAGCCTGTGGGAGG - Intronic
1088605348 11:111524972-111524994 TTGGAGGCTGAGGCTGAGGTGGG - Intronic
1089492812 11:118894365-118894387 CAGGAAGATGACGATGTGGTAGG - Exonic
1090045366 11:123327275-123327297 CAGGAGGTGGAGGTTGTGGTGGG + Intergenic
1090149324 11:124365941-124365963 CTGGTGGTTTTCACTGTGGTTGG - Intergenic
1090348856 11:126093695-126093717 CGGGAGGTTGAGGCTGCAGTGGG - Intergenic
1090643574 11:128749373-128749395 CTGGAGGTTGACGCTGTGGTTGG + Intronic
1090771983 11:129928842-129928864 CAGGAGGTTCTTGCTGTGGTTGG - Intronic
1091691029 12:2597689-2597711 CTGGAGGGAGGAGCTGTGGTGGG - Intronic
1092678859 12:10954539-10954561 CAGGAGGTAGAGGTTGTGGTAGG - Intronic
1093017073 12:14165329-14165351 CAGGAGGTTGAGGCTGCAGTGGG + Intergenic
1093539858 12:20268596-20268618 CTGCAGGTTGACTTTGTGCTCGG - Intergenic
1094201378 12:27797907-27797929 CTGGCGGGTGACGGTGTTGTAGG - Exonic
1094820086 12:34217787-34217809 CGGGAGGTGGAGGCTGCGGTGGG + Intergenic
1095094657 12:38139693-38139715 GGGGAGGTAGAGGCTGTGGTGGG - Intergenic
1096067778 12:48754818-48754840 CAGGAGGTTGAAGCTGCAGTGGG - Intergenic
1096710319 12:53450966-53450988 CAGGAGGCTGAGGTTGTGGTGGG + Intergenic
1096825943 12:54277952-54277974 CTGGAAGCTGAGGCTGAGGTAGG - Intronic
1097084952 12:56460590-56460612 GTGGAGGTTGAGGCTGCAGTGGG + Intronic
1097124798 12:56765615-56765637 CTGGAGGCTGACACGGTGGGGGG - Intronic
1097860907 12:64517690-64517712 CAGGAGGTTGAGGCTGCAGTGGG - Intergenic
1097942181 12:65322547-65322569 CTGGAGGCTGAGGCTGAGGCAGG + Intronic
1098337508 12:69419292-69419314 CAGGAGGTTGAGGCTGCAGTGGG - Intergenic
1100432747 12:94545234-94545256 CTGGAGGTAGACGGTGGGGATGG + Intergenic
1101095066 12:101329919-101329941 CAGGAGATTGAGGCTGTAGTAGG + Intronic
1101877108 12:108603312-108603334 CTGGAGCTGGGGGCTGTGGTGGG - Intergenic
1102250601 12:111384419-111384441 CAGGAGGTTGACACTGCAGTGGG + Intergenic
1102326060 12:111985659-111985681 CAGGAGGTTGAGGCTGCCGTGGG - Intronic
1103038089 12:117672696-117672718 CTGGAGGCAGAGGTTGTGGTGGG - Intronic
1105046059 12:133004557-133004579 CAGGAGTTTGAGGCTGTAGTTGG - Intronic
1106275645 13:28203375-28203397 CAGGAGGTAGACGCTGCAGTGGG - Intronic
1106682634 13:32024115-32024137 CGGGAGGTGGAGGTTGTGGTAGG - Intergenic
1106932043 13:34676902-34676924 CTGGTGGGGGAGGCTGTGGTTGG - Intergenic
1108725881 13:53180774-53180796 TTGGAGGTTAAAGCTATGGTAGG - Intergenic
1108835778 13:54545925-54545947 CAGGAAGTTGAGGCTGTAGTGGG - Intergenic
1110470800 13:75857504-75857526 CTGGATGCTGACACTGAGGTTGG + Intronic
1111311295 13:86490000-86490022 CAGGAGGTGGAGGCTGTAGTGGG + Intergenic
1112571323 13:100596194-100596216 CAGGAGGTTGAGGCTGCAGTGGG + Intergenic
1113799463 13:113078776-113078798 CTGGTGGTTCAGGCTGCGGTCGG - Intronic
1114518458 14:23317367-23317389 CAGGAGTTTGAGGGTGTGGTCGG + Intronic
1114566230 14:23635134-23635156 CAGGAGGTCAAGGCTGTGGTAGG - Intronic
1115540772 14:34418731-34418753 CGGGAGGTGGAGGTTGTGGTGGG - Intronic
1115647240 14:35377471-35377493 CAGGAGGTCGAGGCTGTGGTGGG + Intergenic
1119063330 14:71499267-71499289 GCGGAGGTTGAGGCTGTAGTGGG + Intronic
1119372317 14:74157538-74157560 CAGGAGGTCGAAGCTGAGGTGGG - Intronic
1119561897 14:75597205-75597227 CAGGAGGTTGAGGCTGCAGTGGG + Intronic
1119945153 14:78685704-78685726 CAGGAGGTGGAGGTTGTGGTGGG - Intronic
1120884991 14:89445046-89445068 CAGGAGGTTGAGGCTGAAGTGGG + Intronic
1122213313 14:100187228-100187250 CAGGAGGTTGAGGCTGTAGTGGG + Intergenic
1122326445 14:100883511-100883533 CTGGACCGCGACGCTGTGGTAGG + Exonic
1122966995 14:105135720-105135742 CGGGAGGTTGAGGCTGGGGCAGG + Intergenic
1125095092 15:35841492-35841514 CTGGAGGCTGAAGCTCTGATGGG - Intergenic
1125130701 15:36280788-36280810 CGGGAGTTTGAGGCTGTGGCAGG - Intergenic
1125592202 15:40861822-40861844 CTGGAGGCTGAGGCTGAGGCAGG - Intergenic
1125782001 15:42277672-42277694 CAGGAGGTGGAGGTTGTGGTGGG - Intronic
1125953891 15:43776429-43776451 CTGGAGGTGGAAGGTGCGGTCGG - Intronic
1126379262 15:48029367-48029389 CGGGAGGTGGAGGTTGTGGTTGG - Intergenic
1126522042 15:49605919-49605941 CTGGAGCTTGGGGCTGTGGAGGG + Intronic
1128085747 15:64885461-64885483 CAGGAGGTTGAGGCTGCAGTGGG + Intronic
1129098061 15:73230662-73230684 CAGGAGGTTGAGGCTGCAGTGGG - Intronic
1129419520 15:75412849-75412871 GTGGTGGTTGAGGCTGTGGCTGG + Exonic
1130542960 15:84835118-84835140 CTGGAGACTGAGGCTGTGCTGGG + Intronic
1132145203 15:99425412-99425434 GTGGAGGGTGAGGCTGGGGTGGG + Intergenic
1132635767 16:945450-945472 CAGGAGGTTGAGGCTGCAGTGGG + Intronic
1133455600 16:5939858-5939880 TTGCAGGTTGACAGTGTGGTGGG + Intergenic
1133732789 16:8590554-8590576 CTGGAGGCTGCCGGTGTGGAAGG + Intergenic
1133776287 16:8897823-8897845 CAGGAGGTCTACGCTGTCGTGGG + Intronic
1133786612 16:8978664-8978686 CAGGAGGTTGACGCTGCAATGGG + Intergenic
1133808453 16:9143320-9143342 CAGGAGGTTGAGGCTGCAGTGGG + Intergenic
1133921556 16:10158076-10158098 CAGGAGGTTGAGGCTGCAGTGGG - Intronic
1133977554 16:10610596-10610618 CTGGGGGTTGAAGCTGTAGTGGG - Intergenic
1134036624 16:11036217-11036239 CTGGAGGGTGATGCAGTGGAGGG - Intronic
1134481005 16:14619127-14619149 GAGGAGGTTGAGGCTGTAGTGGG + Intronic
1134593230 16:15474436-15474458 CAGGAGGTTGAGGCTGCAGTGGG - Intronic
1135529381 16:23239631-23239653 CGGGAGGTTGAGGCTGCAGTCGG - Intergenic
1136173231 16:28500685-28500707 CAGGAGGCAGACGCTGTGCTGGG + Intronic
1136482224 16:30549284-30549306 CAGGAGGTTGAGGCTGCAGTGGG + Intronic
1136536259 16:30901682-30901704 CCGGAGGCTGAGGCTGAGGTGGG - Intronic
1136649244 16:31652100-31652122 CAGGAGGTGGAGGTTGTGGTGGG + Intergenic
1137988009 16:53127026-53127048 CAGGAGGTTGAGGCTGTAGTGGG - Intronic
1138365187 16:56469774-56469796 CAGGAGGTGGAGGTTGTGGTGGG + Intronic
1139069709 16:63365110-63365132 CTGGAGGCTGACGAGGTGGGAGG + Intergenic
1139518861 16:67468216-67468238 CAGGAGGTTGAGGCTGCAGTGGG + Intronic
1139672418 16:68500772-68500794 CAGGAGGTTGAGGTTGAGGTGGG + Intergenic
1139837956 16:69854927-69854949 TTGGAGGTTGAGGCTGCAGTGGG - Intronic
1140453443 16:75090050-75090072 CTGCAGGCTGAGGCTGTGGAAGG - Intronic
1141362146 16:83405802-83405824 TTGGAGGCAGAGGCTGTGGTTGG + Intronic
1141734704 16:85844414-85844436 CAGGAGGTTGAGGCTGCAGTGGG - Intergenic
1142092512 16:88222360-88222382 CAGGAGGTTGAGGCTGCAGTGGG - Intergenic
1142342378 16:89532061-89532083 TTGGAGGTAGGTGCTGTGGTTGG + Exonic
1142549116 17:727305-727327 CGGGAGGTTGAGGCTGCAGTGGG - Intergenic
1142646233 17:1315585-1315607 CTGGAGCTGGATGCTTTGGTCGG + Intergenic
1142674110 17:1502961-1502983 CAGGAGGTTGAGGCTGTAGTGGG - Intronic
1142680242 17:1543382-1543404 CGGGAGGTAGAGGCTGGGGTAGG - Intronic
1143249845 17:5515097-5515119 TTGGAGGTGGAGGCTGTGGTTGG - Intronic
1143822578 17:9576735-9576757 CTGGAACTTGACGCCGTGATCGG + Exonic
1144558850 17:16305169-16305191 CAGGAGGCTGAGGCTGAGGTGGG + Intronic
1144564754 17:16351004-16351026 CTGGAGGTGGAGGTTGCGGTGGG - Intronic
1145104785 17:20105870-20105892 CTGGGGATGGAGGCTGTGGTGGG + Intronic
1146306797 17:31736162-31736184 CAGGAGGTTGAGGCTGCAGTGGG + Intergenic
1147236998 17:39065473-39065495 CGGGAGGTTGAGGCTGCAGTGGG - Exonic
1148168063 17:45497599-45497621 GTGGGGGTTGGCGCTGAGGTGGG + Intergenic
1148329263 17:46803705-46803727 CTGGAGCTTGAGGGTGTGGCTGG - Intronic
1149146345 17:53497835-53497857 CAGGAGGTTGAAGCTGCAGTGGG + Intergenic
1149459637 17:56817528-56817550 CAGGAGGTTGAGGCTGTAGTGGG - Intronic
1149912015 17:60575475-60575497 CAGGAGTTTGAGGCTGTAGTGGG - Intronic
1149940150 17:60855756-60855778 CTGGGGGTTGAGGCTGCAGTGGG - Intronic
1151099920 17:71545041-71545063 CAGGAGGTCAAGGCTGTGGTGGG + Intergenic
1152096613 17:78276047-78276069 CAGGAGGTGGAGGTTGTGGTGGG + Intergenic
1152126135 17:78448096-78448118 CGGGAGGTGGAGGTTGTGGTGGG + Intronic
1152177194 17:78795549-78795571 CTGGAAGTTGAGGCTGGGCTAGG - Intronic
1152904603 17:82963329-82963351 CTGGAGGTTCGCGCTGGGGATGG - Intronic
1153446498 18:5178713-5178735 CAGGAAGTTGACTGTGTGGTTGG - Intronic
1154229628 18:12543356-12543378 CAGGAGGTTGAGGCTGCAGTGGG - Intronic
1155176182 18:23303216-23303238 CTGGTGGTTCACTTTGTGGTTGG + Intronic
1156036212 18:32770532-32770554 CAGCAGGTTGTCGCTGTGGCTGG + Exonic
1158009006 18:52706989-52707011 ATGGAGGTAGAAGCTGGGGTTGG + Intronic
1158374774 18:56850581-56850603 CAGGAGGTTGAGGCTGCAGTGGG - Intronic
1158603742 18:58876815-58876837 CGGGAGGCTGAGGCTGAGGTGGG + Intronic
1160917211 19:1502932-1502954 CAGGAGGTTGAGGCTGCAGTGGG + Intergenic
1161036587 19:2088375-2088397 CCGGAGGTTGAGGCTGGAGTGGG - Intronic
1161043809 19:2123830-2123852 CTGGATGCTGGCGCTGTGGTTGG + Exonic
1161207984 19:3051808-3051830 CAGGAGGCTGAGGCTGAGGTGGG + Intergenic
1161940638 19:7401357-7401379 CAGGAGGTTGAGGCTGCAGTGGG - Intronic
1162126497 19:8502343-8502365 CTGGGGGTTCACGCTCAGGTTGG - Intronic
1163493252 19:17629765-17629787 TTGGAGTTTGAGGCTGTGCTGGG - Intronic
1163797499 19:19345928-19345950 GAGGAGGTTGAGGCTGAGGTGGG - Intronic
1164435841 19:28228594-28228616 CTGGAGGGAGAGGCTGTGGATGG - Intergenic
1164521406 19:28982811-28982833 CCGGAGGTGGAGGCTGTGGTGGG + Intergenic
1165112540 19:33510806-33510828 CTGGAGTATGACTGTGTGGTAGG - Intronic
1165323840 19:35102545-35102567 CAGGAGGCTGAGGCTGAGGTGGG + Intergenic
1166141878 19:40809602-40809624 CAGGAGCTGGACCCTGTGGTAGG - Intronic
1166185646 19:41137177-41137199 CAGGAGCTGGACCCTGTGGTAGG + Intergenic
1166314824 19:41983680-41983702 CGGGAGGTTGAGGCTGTAGTGGG - Intronic
1167214453 19:48155095-48155117 CTCCAGGTGGACGCTGAGGTTGG - Intronic
1167367547 19:49062708-49062730 CAGGAGGTGGAGGTTGTGGTGGG + Intronic
1167728533 19:51235653-51235675 GGGGAGGCTGACCCTGTGGTAGG - Exonic
1167852389 19:52212157-52212179 CAGGAGGTTGAGGCTGCAGTGGG - Intronic
1168021195 19:53609909-53609931 CGGGAGGTGGAGGTTGTGGTGGG + Intergenic
1168260817 19:55193355-55193377 TGGGAGGTGGAGGCTGTGGTGGG + Intronic
924998390 2:384722-384744 CAGGAGGTTGAACCTGAGGTGGG + Intergenic
928925535 2:36575256-36575278 CAGGAGGTTGAGGCTGCAGTGGG - Intronic
931095932 2:58941224-58941246 CTGGAGGTTGAAGCTGCAGTGGG - Intergenic
931665569 2:64607922-64607944 CTGGAGGCTGAAGCTTTGCTTGG - Intergenic
934723103 2:96595619-96595641 CTGGAGGCAGGCGCTGTGGCAGG + Exonic
935108393 2:100068409-100068431 CTGTTTGTTGAGGCTGTGGTGGG + Intronic
936297364 2:111277159-111277181 CTGAAGGTTAACGCTGTAGCGGG - Intergenic
936452847 2:112646197-112646219 CTGGAGGCGGACGCCGTGGGCGG + Intronic
938908600 2:135863654-135863676 CAGGAGGTTGAGGCTGTAGTAGG + Intronic
940777197 2:157897465-157897487 CGGGAGGTTGAGGCTGCAGTGGG - Intronic
943892433 2:193307240-193307262 CCAGAGGTAGAAGCTGTGGTGGG + Intergenic
944194455 2:197037866-197037888 CAGGAGGTTGAGGCTGTAGTGGG + Intronic
944460200 2:199941130-199941152 CAGGAGGTTGAGGCTGCAGTGGG - Intronic
944512009 2:200474378-200474400 CAGGAGGTTGAGGCTGCAGTGGG - Intronic
944784432 2:203054060-203054082 CAGGAGGCTGAGGCTGAGGTGGG - Intronic
944798815 2:203215395-203215417 CTGGAGGTGGAGGCTGAGGCAGG + Intronic
945663782 2:212717460-212717482 CTGGAGATTGAGGCAGTGGTTGG + Intergenic
945825313 2:214714280-214714302 TAGGAGTTTGAGGCTGTGGTGGG + Intergenic
947357919 2:229316205-229316227 CTGGAGGTTGAGGCTTTTGTGGG - Intergenic
947679742 2:232019472-232019494 CTGGAGTTGGAGGCTATGGTAGG + Intronic
947874302 2:233458317-233458339 CTGGAGGTGGTCGCCGTGTTCGG + Exonic
1169272023 20:4207844-4207866 CAGGAGGCTGAAGCTGAGGTGGG + Intergenic
1169374937 20:5058749-5058771 CAGGAGGCTGAGGCTGAGGTGGG + Intergenic
1171219757 20:23384508-23384530 CTGGAGGCTAAGGCTGAGGTGGG + Intronic
1171353351 20:24522588-24522610 CTGTGGGATGAGGCTGTGGTTGG + Intronic
1172069610 20:32246952-32246974 TTGGAGGTTGAGGCTGTAGTGGG - Intergenic
1172137108 20:32694240-32694262 CAGGAGGTCGAGGCTGCGGTGGG + Intergenic
1172252938 20:33492586-33492608 CAGGAGGTTGAGGCTGCTGTGGG - Intronic
1173784578 20:45783402-45783424 CAGGAGGTTGAGGCTGCAGTGGG + Intronic
1173870282 20:46337509-46337531 CTGGAAGTTGAGGCTGCAGTGGG + Intergenic
1173922843 20:46758966-46758988 CTGGAGGTGGGCACTGTGGGAGG - Intergenic
1174506234 20:51019435-51019457 CAGGAGGTCAAGGCTGTGGTGGG + Intronic
1174750340 20:53105718-53105740 CAGGAGGTTGAAGCTATAGTGGG - Intronic
1174809181 20:53631279-53631301 CAGGAGTTTGAGGCTGTAGTGGG + Intergenic
1175144616 20:56886187-56886209 CTGGAGGCTGGTGCTGGGGTAGG + Intergenic
1175235875 20:57511113-57511135 CAGGAGGTTGAGGCTGCAGTAGG - Intronic
1175455745 20:59112270-59112292 CAGGAGGTTGAGGCTGCAGTGGG + Intergenic
1175600823 20:60271345-60271367 CAGGAGGTGGAGGCTGTAGTGGG + Intergenic
1180680507 22:17622890-17622912 CTGGAGGCGGAGGTTGTGGTAGG + Intronic
1180697594 22:17762622-17762644 CAGGAGTTTGAGGCTGTAGTGGG - Intronic
1180919484 22:19513548-19513570 CTGTAGGTCCAGGCTGTGGTGGG - Intronic
1181956987 22:26594615-26594637 CGGGAGGTGGAGGTTGTGGTGGG + Intronic
1182320490 22:29475758-29475780 CTGGGGGTTAAGGCTGTGGGTGG + Intergenic
1183825775 22:40385923-40385945 CGGGAGGTCGACGCTGCAGTGGG - Intronic
1184730485 22:46368733-46368755 CTGGAGGTTCCCTCTGTGCTGGG + Intronic
1185138075 22:49084746-49084768 CTTGAAGATGAAGCTGTGGTGGG - Intergenic
949725120 3:7035124-7035146 CTGTTGGTTTACCCTGTGGTAGG + Intronic
950097072 3:10336641-10336663 GTGGAGGTAGAGGGTGTGGTGGG + Intronic
950237871 3:11339446-11339468 CTGGAAGTGTAGGCTGTGGTGGG + Intronic
950723839 3:14902942-14902964 CTGAAGTTGGACGCTGTGCTGGG + Intronic
953150010 3:40316187-40316209 CAGGAGGTGGAGGTTGTGGTGGG - Intergenic
953311033 3:41879567-41879589 TGGGAGGTTGAGGCTGTAGTGGG - Intronic
953861925 3:46551872-46551894 CAGGAGGTTGAGGCTGCAGTTGG - Intronic
953962763 3:47280062-47280084 CTGGAGGTTGAGGTTGAGGTGGG - Intronic
954023569 3:47763790-47763812 CAGGAGGTTGAGGCTGCAGTGGG - Intronic
954173943 3:48828271-48828293 CAGGAGTTTGAGGCTGTTGTGGG - Intronic
955118766 3:56033905-56033927 CTGTAGGTGGAGGCTGAGGTGGG - Intronic
955458188 3:59148995-59149017 CAGGAGTTCGAGGCTGTGGTAGG - Intergenic
956055922 3:65298948-65298970 CAGAAGGTTGAGGCTGTAGTGGG - Intergenic
956218168 3:66871892-66871914 CTGGAGGTGGAGGTTGCGGTGGG + Intergenic
956444157 3:69309234-69309256 CAGGAGGCTGAGGCTGAGGTGGG - Intronic
958589895 3:96142766-96142788 CTGGAAGCTAACCCTGTGGTAGG - Intergenic
959095365 3:101949782-101949804 CAGGAGGTTGAGGCTGCAGTGGG - Intergenic
959151513 3:102613303-102613325 CAGGAGGTTGAGGCTGCAGTGGG + Intergenic
959817539 3:110692575-110692597 CTGGGGGTTGAGGTTGTGGTGGG - Intergenic
961840813 3:129710110-129710132 CGGGAGGTGGAGGTTGTGGTGGG + Intronic
964310282 3:155385063-155385085 CTTGAGGTTGACTCTGAAGTGGG - Intronic
966709055 3:182951540-182951562 CAGGAGGTTGAGGCTGCAGTGGG + Intronic
966942583 3:184756297-184756319 CTGGAGGTGGAGGGTGGGGTGGG - Intergenic
968126895 3:196166644-196166666 CTGGAGGTGGTAGCGGTGGTGGG + Intergenic
969412492 4:7038473-7038495 CAGGAGGCTGAGGCTGAGGTGGG - Intergenic
969635610 4:8367916-8367938 CAGGAGGTTGAGGCTGCAGTGGG + Intronic
969635757 4:8368800-8368822 GGGGAGGTCGAGGCTGTGGTGGG - Intronic
969637883 4:8379857-8379879 CAGGAGGTTGAGGCTGCAGTAGG - Intronic
970709560 4:18846049-18846071 CAGGAGGTTAACTCTATGGTTGG - Intergenic
971083288 4:23240684-23240706 CAGGAGGTTGAGGCTGTAGTGGG + Intergenic
971937511 4:33171282-33171304 CTGGAGGTGGAGGCTGCAGTGGG + Intergenic
972370319 4:38417211-38417233 CTGGAGGTGGAGTCTGTGGGAGG - Intergenic
973303739 4:48619585-48619607 CAGGAGGTTGAAGCTGCGGTGGG - Intronic
976293065 4:83441845-83441867 CTGGAGGTTGAGGCTGCAGTGGG - Intronic
978241460 4:106521497-106521519 CTGGAGGGGGAGGCTGAGGTGGG - Intergenic
979654848 4:123180392-123180414 CTTGTGGTTGACACTGTAGTGGG + Intronic
979730335 4:124016251-124016273 CTTGAAGTTGACACTGTGGCTGG + Intergenic
979750017 4:124267630-124267652 CGGGAGGTTGAGGCTGCAGTGGG + Intergenic
980161670 4:129171268-129171290 CAGGAGGTTGAGGCTGCAGTGGG + Intergenic
981347780 4:143696902-143696924 CTTGAGGGTGAAGCTGTGGATGG + Exonic
981514066 4:145588072-145588094 CTGGGGATTGAGGCTGTTGTTGG - Intergenic
981807659 4:148735325-148735347 GAGGAGGTTGAGGCTGCGGTGGG + Intergenic
982677609 4:158394119-158394141 CAGGAGGTTGAGGCTGCAGTGGG + Intronic
984653785 4:182296023-182296045 CAGGAGGTGGAGGCTGAGGTGGG - Intronic
984753006 4:183297046-183297068 TGGGAGGTTGAGGCTGTAGTGGG - Intronic
985552777 5:541756-541778 CTTGAGGATGACACTGGGGTGGG + Intergenic
985649759 5:1101968-1101990 CCGGAGGTTGCCTCTGTGGCTGG - Intronic
986195800 5:5535577-5535599 CTCGAGGTGGAGGCTGTGGTGGG + Intergenic
986311664 5:6555799-6555821 CAGGAGTTTGAGGCTGTGGTGGG - Intergenic
986672076 5:10151215-10151237 CAGGAGGTTGAGGCTGGAGTGGG + Intergenic
988318400 5:29660892-29660914 CTGAGGGTTGACCCTGTTGTTGG + Intergenic
989002523 5:36775872-36775894 CTGGAGGTTGATGCTGATATAGG - Intergenic
989339521 5:40357689-40357711 TAGGAGGTGGGCGCTGTGGTAGG + Intergenic
989594812 5:43146481-43146503 CTGGAGGCTGAGGCTGAGGCAGG + Intronic
989628388 5:43455347-43455369 CCGGAGGTTGAGGCTGCAGTGGG + Intronic
992012104 5:72539225-72539247 ATGGAGGATGACTCTGTGGCAGG - Intergenic
992463221 5:76982326-76982348 CAGGAGGTTGAGGCTGTAGTGGG + Intergenic
995525820 5:113049824-113049846 CTGGAGGTTGATGCTGCTGCAGG - Intronic
997924272 5:138014008-138014030 TGGGAGGTTGAGGCTGTGGTGGG - Intronic
999003410 5:147948175-147948197 CGGGAGGCTGAGGCTGTGGCAGG - Intergenic
999192243 5:149757000-149757022 CTGAAGGATGATGCTGAGGTGGG - Intronic
1001463701 5:171942726-171942748 CAGGAGGTTGAGGCTGCAGTGGG + Intronic
1002640013 5:180626301-180626323 CATGAGGTTGGGGCTGTGGTGGG - Intronic
1003852907 6:10243064-10243086 TAGGAGTTTGATGCTGTGGTGGG - Intergenic
1003874880 6:10426344-10426366 CTGGCGGTTCACGCTGCGCTCGG + Intergenic
1004644112 6:17543081-17543103 CTGGTGTTTGACAATGTGGTGGG + Exonic
1004872694 6:19923187-19923209 CAGGAGGTTGAGGCTGCAGTGGG - Intergenic
1005873312 6:29993719-29993741 CTGGCCGTTGATGCTGTGTTGGG + Intergenic
1006000925 6:30964538-30964560 CCTGAGGTGGAAGCTGTGGTGGG - Intergenic
1006536896 6:34706576-34706598 CAGGAGATTGAGGCTGCGGTGGG - Intergenic
1006598921 6:35213272-35213294 CTTGAGGTTGGGGGTGTGGTAGG + Intergenic
1007708880 6:43808679-43808701 CAGGAGGTTGAGGCTGTCGTGGG + Intergenic
1007778946 6:44240374-44240396 CAGGAGGTTGAGGCTGCAGTGGG + Intergenic
1009576652 6:65471320-65471342 CAGGAGGTTGAGGCTGCTGTGGG + Intronic
1010486916 6:76425806-76425828 ATGGAGGTGGAAGCTGTGTTTGG + Intergenic
1011088575 6:83570537-83570559 CTGGAGGTTTACGGGGTGGCGGG + Intronic
1011488323 6:87866466-87866488 CGGGAGGTGGAGGTTGTGGTGGG - Intergenic
1011668615 6:89660257-89660279 CAGGAGGTTGAGGCTGCAGTAGG - Intronic
1012547248 6:100433626-100433648 CCGGAGGCTGAGGCTGTGGGAGG + Intronic
1014281094 6:119443280-119443302 CGGGAGGTTGAGGCTGCAGTGGG - Intergenic
1015575549 6:134667066-134667088 CAGGAGGTTGAGGCTGCAGTGGG + Intergenic
1017582289 6:155879286-155879308 CGGGAGGTTGAGGCTGAGGCAGG + Intergenic
1017720676 6:157241085-157241107 ATGGAGGTAGACGCTGCAGTGGG + Intergenic
1017937593 6:159019896-159019918 CAGGAGGTTGAGGCTGCAGTAGG + Intergenic
1018222041 6:161590657-161590679 CAGGAGGTGGAGGTTGTGGTGGG + Intronic
1018853454 6:167658112-167658134 CTGGAAATTGAATCTGTGGTGGG - Intergenic
1019971282 7:4542919-4542941 CTGGTGGTTGAGGCTGTGCATGG + Intergenic
1020959077 7:14779429-14779451 CAGGAGGTTGAGGCTGAGGATGG + Intronic
1021852455 7:24821945-24821967 CTGGAGGTCAAGGCTGTAGTGGG - Intronic
1023944834 7:44795487-44795509 CCGGAGGTCGAGGCTGTAGTGGG - Intergenic
1023965673 7:44962079-44962101 CTGGAGGCTGAGGCTGGGGTAGG + Intergenic
1025235195 7:57229852-57229874 CGGGAGGTTGAGGCTGCAGTGGG - Intergenic
1026557942 7:71423846-71423868 CAGGAGGTCGAGGCTGTAGTGGG + Intronic
1026700166 7:72634250-72634272 TGGGAGGTTGAGGCTGTAGTGGG - Intronic
1027175748 7:75902225-75902247 CAGGAGGTTGAAGCTGCAGTGGG - Intronic
1027364385 7:77442178-77442200 CAGGAGGTTGAGGCTGCAGTGGG + Intergenic
1029429105 7:100518024-100518046 CTGGAGGTTGAGGCAGCAGTGGG - Intergenic
1029549223 7:101228180-101228202 TGGGAGGTTGAGGCTGTGGTGGG + Intergenic
1032129928 7:129219587-129219609 CAGGAGTTTGAGGCTGTAGTGGG - Intergenic
1032402658 7:131634715-131634737 CGGGAGGTGGAGGCTGTAGTGGG - Intergenic
1033420824 7:141203362-141203384 CTAAAGGCTGACACTGTGGTGGG + Intronic
1033757048 7:144403994-144404016 CTGGAGGGCGAGGCTGGGGTGGG + Intronic
1033782104 7:144683694-144683716 CAGGAGGTTGAGGCTGCAGTGGG - Intronic
1034893954 7:154863427-154863449 CTGGAGGTCGAGGCTGCAGTGGG - Intronic
1035695830 8:1595112-1595134 CGGGAGGTTGAGGCTGCAGTGGG - Intronic
1036084333 8:5597543-5597565 CAGGAGGTTGAGGCTGTAGTGGG + Intergenic
1037558611 8:20052466-20052488 CAGGAGATAGAGGCTGTGGTGGG - Intergenic
1038964742 8:32559003-32559025 CAGGAGGTTGAGGCTGTGGTGGG + Intronic
1039080947 8:33733487-33733509 CAGGAGGTTGAAGCTGCAGTGGG - Intergenic
1039645979 8:39283335-39283357 CAGGAGGTTGAGGCTGTGGTGGG + Intronic
1039990901 8:42486938-42486960 CAGGAGGTGGAGGTTGTGGTGGG - Intronic
1040065992 8:43144249-43144271 CAGGAGGTTGAGGCTGCAGTGGG + Intronic
1040280350 8:46038355-46038377 CGGGTGGTGGAGGCTGTGGTGGG + Intergenic
1040386657 8:46918919-46918941 CTGGGGGTGGAGGCTGTGGCTGG - Intergenic
1040893200 8:52338809-52338831 CAGAAGGTTGAGGCTGTAGTGGG - Intronic
1041046943 8:53896203-53896225 CAGGAGGTTGAGGCTGCAGTGGG + Intronic
1043263153 8:78227304-78227326 CTGGTGGTTGAGGCTGCAGTGGG - Intergenic
1043893857 8:85721624-85721646 CGGGAGGTGGAGGCCGTGGTGGG - Intergenic
1043898465 8:85757102-85757124 CGGGAGGTGGAGGCCGTGGTGGG + Intergenic
1043900077 8:85769297-85769319 CGGGAGGTGGAGGCCGTGGTGGG + Intergenic
1043903649 8:85796765-85796787 CGGGAGGTGGAGGCCGTGGTGGG + Intergenic
1043905260 8:85808958-85808980 CGGGAGGTGGAGGCCGTGGTGGG + Intergenic
1045201286 8:99984211-99984233 AGGGAGGTTGACGCTGCAGTGGG + Intronic
1045272665 8:100675139-100675161 CAGGAGGTTGAGGCTGCAGTGGG - Intergenic
1045575812 8:103418457-103418479 CTGGAGGTTGAGGCTGCAGTAGG + Intronic
1048212356 8:132465836-132465858 CAGGAGGTCGAGGCTGTGGTGGG + Intronic
1048882927 8:138885127-138885149 CTGGAGGGTGACCCTGCAGTAGG - Intronic
1049450241 8:142657307-142657329 CTGGAGGCAGACACAGTGGTGGG + Intergenic
1049743083 8:144250282-144250304 CAGGAGGTACACGCTGTGCTGGG - Exonic
1049805858 8:144538644-144538666 CGGGAGGTGGAGGCTGCGGTGGG - Intronic
1051193860 9:14542307-14542329 CTGGATGAAGACGCTGTGGAGGG + Intergenic
1051245638 9:15108250-15108272 CAGGAGGTTGAGGCTGCTGTGGG + Intergenic
1051271362 9:15358443-15358465 CAGGAGGTTGAGGCTGTGGTGGG - Intergenic
1054800490 9:69343550-69343572 CAGGAGGCTGAGGCTGAGGTGGG - Intronic
1055536956 9:77257690-77257712 CAGGAGGTTGAGGCTACGGTGGG + Intronic
1056617659 9:88182113-88182135 CTGGAGGCGGAGGTTGTGGTGGG + Intergenic
1057165504 9:92922015-92922037 CAGGAGGTTGAGGCTGAGGTGGG - Intergenic
1057806637 9:98224354-98224376 CAGGAGGTTGAGGCTGCGGTGGG - Intronic
1058531488 9:105909969-105909991 ATGAAAGTTGACTCTGTGGTAGG + Intergenic
1059174072 9:112153191-112153213 CAGGAGGCTGAGGCTGTAGTGGG + Intronic
1061355145 9:130098900-130098922 CAGGAGGTTGAGGCGGTGGGGGG + Intronic
1061412781 9:130430320-130430342 CTGGAGGTTGTGGCACTGGTAGG - Exonic
1061957928 9:133973248-133973270 CAGGGGGTTGACGCTCTGGGCGG - Intronic
1062036437 9:134384645-134384667 CTGGAGGAAGAGGCTGCGGTGGG + Intronic
1185851953 X:3497741-3497763 CAGGAGGTTGAGGCTGCAGTGGG - Intergenic
1185871269 X:3666832-3666854 CAGGAGGTTGAGGCTGCAGTGGG + Intronic
1186477615 X:9870150-9870172 CGGGAGGTGCAGGCTGTGGTGGG + Intronic
1186509665 X:10121273-10121295 CTGGGGGTTGATGCAGTGGTTGG + Intronic
1187878222 X:23821909-23821931 CAGGAGGTTGAGGCTGCAGTGGG - Intergenic
1188478726 X:30614806-30614828 CAGGTGGTTAAGGCTGTGGTGGG + Intergenic
1189534812 X:41924521-41924543 CTGGGTGTTGCCGCTGTGCTAGG + Intergenic
1189728278 X:43990772-43990794 CAGGAGGTTGAGGCTGCAGTGGG - Intergenic
1191752393 X:64557045-64557067 CAGGAGGTTGAAGCTGCAGTGGG + Intergenic
1196343666 X:114626313-114626335 CAGGAGGTTGAGGCTGCAGTGGG + Intronic
1197890068 X:131261409-131261431 CTGGAGATTAAGACTGTGGTGGG + Intergenic
1200061721 X:153486758-153486780 CTGGAGGACCACGCTGTGATAGG - Exonic
1200788854 Y:7282141-7282163 CAGGAGGTTGAGGCTGCAGTGGG + Intergenic