ID: 1090644224

View in Genome Browser
Species Human (GRCh38)
Location 11:128754661-128754683
Sequence GTTTTTGAGCAGATTGTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 193}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090644221_1090644224 0 Left 1090644221 11:128754638-128754660 CCATCTCTAGGGAGCTCTCTGAG 0: 1
1: 0
2: 1
3: 27
4: 210
Right 1090644224 11:128754661-128754683 GTTTTTGAGCAGATTGTGGCAGG 0: 1
1: 0
2: 1
3: 22
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090644224 Original CRISPR GTTTTTGAGCAGATTGTGGC AGG Intronic
900548582 1:3242152-3242174 GTTTGTGAGCAGGTACTGGCAGG + Intronic
901270738 1:7951482-7951504 TTTTTGAAGCACATTGTGGCAGG + Intergenic
904237904 1:29125720-29125742 GGTTTTAAGCAGGTAGTGGCAGG - Intergenic
905843198 1:41203524-41203546 GTTTATGACCAGATTTTGGGGGG - Intronic
906645845 1:47474393-47474415 GTATTTGGGCAGATTATGCCAGG + Intergenic
907230938 1:52997807-52997829 GTTTTTGATCTGGTTTTGGCTGG - Intronic
913667280 1:121059991-121060013 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914018970 1:143847134-143847156 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914657521 1:149755341-149755363 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914774543 1:150724400-150724422 GTTTAAGAGCATGTTGTGGCTGG + Intergenic
915507109 1:156364797-156364819 GGCTCTGAGCAGCTTGTGGCTGG - Intronic
917728103 1:177846969-177846991 GATTTTAAGCAGTGTGTGGCTGG - Intergenic
919045868 1:192450985-192451007 GTTTTTAAGCCCATGGTGGCAGG - Intergenic
920573013 1:207032369-207032391 GTTTTTGTGGAGACTGGGGCTGG - Intronic
921983318 1:221282503-221282525 GTTTTTAAGCAGATTGGGAGAGG - Intergenic
922330849 1:224574438-224574460 ATTGTTGAGCACAATGTGGCTGG - Intronic
924730143 1:246703682-246703704 GTTTTAAAGCAGATTTTGCCCGG - Intergenic
1064960260 10:20955570-20955592 ATTTAGGAGCAGATTGTGGAGGG + Intronic
1067950506 10:50732244-50732266 ATTTTTGATCAGTTTGTGCCTGG + Intergenic
1068146339 10:53075785-53075807 GTTTTTAAGAAAATTGTGGAGGG - Intergenic
1068273717 10:54764173-54764195 ATTTTTGATCAGTTTGTGCCTGG - Intronic
1068525278 10:58122044-58122066 GTTTTTGAGAATAATTTGGCAGG - Intergenic
1070885847 10:79897481-79897503 ATTTTTGATCAGTTTGTGCCTGG + Intergenic
1071163566 10:82779314-82779336 GTTTCTGAGCTGATTTTAGCTGG + Intronic
1074627575 10:115209107-115209129 GTTTTTGAGTTGTTTATGGCAGG - Intronic
1074627593 10:115209439-115209461 GTTTCTGAGTTGTTTGTGGCAGG + Intronic
1075154929 10:119967362-119967384 GTTTTTAAGGAGATTGTGGAGGG + Intergenic
1077180435 11:1210020-1210042 GTTTATGGGCAGATTTTGGGGGG - Intergenic
1084207274 11:67602973-67602995 TTTTTTAAGGAGATTGTGGAGGG + Exonic
1084511473 11:69607358-69607380 GTTTTAGAGTTGTTTGTGGCAGG - Intergenic
1085381343 11:76121931-76121953 GCTTTTGAGCAGCTTGGGTCTGG + Intronic
1086031992 11:82370964-82370986 GTTTTTGACCAGACTTTTGCAGG - Intergenic
1089652339 11:119922446-119922468 CTTTGTGAGCAGAGTGTGGCTGG + Intergenic
1090644224 11:128754661-128754683 GTTTTTGAGCAGATTGTGGCAGG + Intronic
1091279725 11:134374978-134375000 GTTTTTGAGGAGACGATGGCGGG + Exonic
1091408175 12:221692-221714 GGTTTTGGGCAGAGTGTGGATGG - Intronic
1091829273 12:3538131-3538153 CTTTTTGAACGGATTTTGGCAGG - Intronic
1095757328 12:45783525-45783547 GTTTTTCCACAGACTGTGGCAGG + Intronic
1096307676 12:50492349-50492371 GTTTTTGGCCAGATTTTGGGGGG + Intergenic
1098220029 12:68259620-68259642 CTTTGTGGGCAGATTGTGGCAGG - Intergenic
1101073732 12:101105822-101105844 GTTTAATAGCAGATTGAGGCTGG + Intronic
1101345703 12:103884286-103884308 GTTTTTGAGAAGCTTATGTCTGG - Intergenic
1103865386 12:124047741-124047763 GTTTTTCTGCAGATGGGGGCAGG - Intronic
1105989310 13:25602620-25602642 GCATTTGAGCAGTGTGTGGCTGG + Intronic
1106421918 13:29592332-29592354 GCTTTGGACCAGATTCTGGCTGG - Intronic
1106713504 13:32363688-32363710 GTTTTTGTGCAGTTTTTGGGAGG + Intronic
1108563984 13:51676142-51676164 GGTTCTGAGCAGTTTGGGGCAGG - Intronic
1110070419 13:71169254-71169276 CATTTTGAACAGATGGTGGCTGG + Intergenic
1111114908 13:83763120-83763142 GTTTTTGAGCTGTTTTTGGTTGG - Intergenic
1113586552 13:111469857-111469879 AGTTGTGAGCAGATTGGGGCTGG + Intergenic
1114660295 14:24339414-24339436 CTTTTTGGCCAGATTGCGGCTGG + Intronic
1114958049 14:27848338-27848360 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1117366293 14:55031970-55031992 GTTTTTGGGCACATGATGGCAGG + Intronic
1119615953 14:76099334-76099356 GGTGTTGAGCAGAGTGAGGCCGG - Intergenic
1120298008 14:82669145-82669167 GATTTTGAACAGATTTTGCCTGG + Intergenic
1122139109 14:99651779-99651801 GTTTTTCAACAGATAGAGGCCGG + Intronic
1122322152 14:100861630-100861652 TTCTGTGAGCAGCTTGTGGCTGG + Intergenic
1125110262 15:36024139-36024161 AATTTTGAGCAGATTCTGACAGG + Intergenic
1126220087 15:46203605-46203627 GTTTTTAATCAGATGGAGGCTGG + Intergenic
1127595508 15:60478433-60478455 GTTATGGGGCAGATTCTGGCAGG + Intronic
1128981674 15:72192750-72192772 ATTTTTAAGCAGTTTTTGGCTGG - Intronic
1130625501 15:85510000-85510022 GTGTTTGAGAAGACTGTGGGAGG + Intronic
1130741586 15:86606285-86606307 GTTTCTAAGGAGATTGTGGAAGG - Intronic
1132400884 15:101504520-101504542 GTCTTGGAGCGGATTGAGGCTGG - Intronic
1132475311 16:133123-133145 GTTTAAGAGAATATTGTGGCTGG + Intronic
1133903221 16:9996551-9996573 GTCCCTGAGCAGATTGTGGTGGG + Intronic
1134061624 16:11202799-11202821 GATTTTGAGCAGTTAGAGGCTGG + Intergenic
1135539366 16:23318084-23318106 GTTCTGGAGAAGATTGTGTCTGG + Intronic
1136291695 16:29276797-29276819 GTTTTTAAACAGATTGGGGTTGG - Intergenic
1141832777 16:86518921-86518943 GTCTCTGAGCTGATTCTGGCTGG + Intergenic
1142097577 16:88250741-88250763 GTTTTTAAACAGATTGGGGTTGG - Intergenic
1144551354 17:16243931-16243953 GTTTTTAAGCATAATGTGGTGGG + Intronic
1146437245 17:32861654-32861676 GTCTTTGGGCAGAGTGGGGCAGG - Intronic
1149283410 17:55133087-55133109 GTTTGAGAGTAGACTGTGGCAGG + Intronic
1152904550 17:82963112-82963134 TTCTGTGAGCAGATTGGGGCTGG - Intronic
1153597495 18:6742521-6742543 GTGGATGAGCAGATTGTGGATGG + Intronic
1154365927 18:13709097-13709119 GTTTCTGAGCAGAATGTGAGAGG - Intronic
1159537246 18:69729711-69729733 GTATTTGAACAGATTGTGTGTGG - Intronic
1159656797 18:71039097-71039119 GTTTTTGAACAAATTGTGCTGGG - Intergenic
1159768361 18:72518370-72518392 GTTGATGGGCAGATTGTTGCTGG - Intergenic
1160192521 18:76725809-76725831 GTTTTTCCACAGATGGTGGCAGG + Intergenic
1161344082 19:3759419-3759441 GGTTTCGAGCAGATTCCGGCTGG - Intronic
1162066597 19:8129495-8129517 GGTTTAGAGCAGAATGAGGCCGG - Intronic
1165438854 19:35812471-35812493 GTCTATGGGCAGTTTGTGGCTGG - Exonic
1165985862 19:39768339-39768361 GTTTTTAAGCATGTTGTGGGTGG - Intergenic
1168433473 19:56299799-56299821 ATTTTTGACCAGTTTTTGGCTGG + Intronic
924992386 2:323364-323386 GTTTTTGAGCAGGGTGTGGCAGG + Intergenic
927629708 2:24762257-24762279 TTTTTTTAGCTGATTGAGGCAGG + Intronic
928034015 2:27805071-27805093 GTGTTTGAGAAGAATGTGGATGG - Intronic
929651031 2:43679605-43679627 GTTATTCAGGAGATTGAGGCAGG - Intronic
930562524 2:52978282-52978304 GTTTGTGGCCAGATTGTTGCTGG + Intergenic
933544074 2:83687282-83687304 GTTTGGGATCAGATTATGGCAGG + Intergenic
933784757 2:85829698-85829720 GATTTTGAGGAGATTCTGGCTGG - Intergenic
934479252 2:94619706-94619728 GTTTTTAAGGGGATTGTGGCGGG - Intergenic
936443298 2:112574994-112575016 CATTTTAAGCAGATTGTGGCCGG + Exonic
940136117 2:150437326-150437348 GTTTGGGAACAGATTGTGGAAGG + Intergenic
941991716 2:171563406-171563428 GGTCTTGAGCAGATTGTAGGAGG + Intergenic
944214103 2:197236697-197236719 TTTTTTGAGTAGTTTGTTGCAGG - Intronic
945442837 2:209900866-209900888 GTTTAAGAGAATATTGTGGCTGG - Intronic
946073569 2:217054876-217054898 GTTTTTGAACAGATTGTGTTGGG + Intergenic
946110494 2:217410983-217411005 TTTTTTGGCCAGAGTGTGGCAGG + Intronic
1170287908 20:14732186-14732208 ATTTTGGAGGAGACTGTGGCTGG + Intronic
1172348259 20:34221666-34221688 GTTTTTGAGCAGAAAGTAGGTGG + Intronic
1174622236 20:51884587-51884609 GTTTTTCATCAGAATGAGGCTGG - Intergenic
1178493566 21:33069822-33069844 GTTTTTGAGTAGACAGTTGCTGG + Intergenic
1179421355 21:41239171-41239193 GTTTATGAGCAGATGGGGGTGGG + Intronic
1180234572 21:46450011-46450033 GCTTTTGAGGTGATTGTGGTGGG - Intergenic
1182917055 22:34043666-34043688 GGCATTGAGCAGATTGTGGAGGG + Intergenic
1184164469 22:42719739-42719761 GTCTTTGGGCAGCTGGTGGCGGG + Intronic
1185253032 22:49815654-49815676 GTTTTAGTGCAGATTGTAGCTGG - Intronic
1185287114 22:50006655-50006677 TTTTAAGAGCAGATTGGGGCCGG + Intronic
949135455 3:559687-559709 ATTTTTGAGAAAATTGTGGGAGG + Intergenic
949587583 3:5456967-5456989 GCTTTTAAGAAAATTGTGGCTGG - Intergenic
949630712 3:5923378-5923400 GCTTAAGGGCAGATTGTGGCAGG + Intergenic
950408159 3:12817285-12817307 GTTTATGAGCAGGCTGTGGATGG + Exonic
951270155 3:20614848-20614870 GTTTGTGGCCAGATTGTGGGGGG + Intergenic
953742549 3:45550026-45550048 CATTTTGAGCAGAGTGTGGCTGG + Intergenic
955911270 3:63862736-63862758 GTTTTTCAGGAGATGGTGACCGG - Intronic
956674090 3:71718676-71718698 GTTTTTGAGCAGCTAGTGCCAGG + Intronic
959309346 3:104713241-104713263 GTTGTTGAGGAGATTTTGGGGGG - Intergenic
959353159 3:105294121-105294143 GTTATTGAGCAGTATGTGCCAGG - Intergenic
961050525 3:123741927-123741949 GGGTTTGACAAGATTGTGGCTGG - Intronic
963755413 3:149230774-149230796 GTTTTTGAGCACATTGGTGCTGG - Intergenic
965557323 3:170031853-170031875 GTTTATGACCAGATTTTGGAGGG + Intergenic
968764479 4:2461169-2461191 GTTTTTTAGCCCCTTGTGGCTGG + Intronic
969911360 4:10449733-10449755 GTTGGTAAGCAAATTGTGGCAGG - Intronic
970696477 4:18684273-18684295 ATTTGAGAGCAGATTGTGGATGG + Intergenic
974951634 4:68590238-68590260 GTTTGTGATCAGCTTGTGACAGG - Intronic
975596826 4:76055248-76055270 GTATTTGTGCAGTTGGTGGCTGG + Intronic
976689084 4:87849175-87849197 CTTTTTGAGCACAAGGTGGCAGG - Intergenic
977048865 4:92101622-92101644 GTTTATGAAAAGCTTGTGGCTGG - Intergenic
978465844 4:109008114-109008136 GTCTTGGAGCAGATAGTGGTGGG - Intronic
984113084 4:175644233-175644255 GTTTTAGAGCAGGCTGAGGCAGG - Intronic
985625827 5:986387-986409 GTTTATGACCAGATTTTGGGGGG + Intergenic
986214817 5:5709633-5709655 GTTTATGGGCAGATGTTGGCTGG - Intergenic
988344111 5:30014501-30014523 GTTTATGACCAGATTCTGGGGGG + Intergenic
989575628 5:42985494-42985516 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
989598106 5:43176456-43176478 GCTTTTGAGCTGATTTTGGGGGG - Intronic
989848450 5:46176459-46176481 GTTTTTGTGCATTTTGTGGATGG - Intergenic
990300209 5:54442084-54442106 GTTTTTGAGAACACTTTGGCAGG + Intergenic
992896026 5:81245836-81245858 GTTTGAGAGCAGAGTGTTGCTGG - Intronic
995006223 5:107199053-107199075 GTTTTTGTGGAGAATGTGGTAGG + Intergenic
995239914 5:109874004-109874026 ATTTTTGAGCAGAATGTGCGAGG - Intergenic
997184772 5:131870940-131870962 TTTCTTGAGGAGGTTGTGGCAGG - Intronic
997751767 5:136353196-136353218 GGTCTTCAGCAAATTGTGGCTGG - Intronic
1000335802 5:160240476-160240498 GTTTCAGAGCAGAATGTGGGAGG - Intergenic
1004488596 6:16092230-16092252 GTGGTTGAGCTGCTTGTGGCAGG + Intergenic
1005040006 6:21593042-21593064 GTTTTTGTGCTGTTTGTGGAAGG - Exonic
1008218866 6:48829711-48829733 TTGTTTGAACAGATAGTGGCAGG - Intergenic
1011981119 6:93379939-93379961 GTTTTTGAGCAGATTGATACTGG - Intronic
1012676398 6:102118451-102118473 CTTTTTTAGGAGATTGTAGCTGG + Intergenic
1015017965 6:128437287-128437309 GTTTGTGATTAGCTTGTGGCAGG - Intronic
1016972705 6:149779339-149779361 CCTTTTAAGCAGTTTGTGGCAGG - Intronic
1017348055 6:153407260-153407282 GTTTTTAAGCAAATTATGGGAGG - Intergenic
1017568243 6:155711781-155711803 ATTTTTGAGCATGTTTTGGCAGG + Intergenic
1019874768 7:3800056-3800078 GTTTTTGGTGAGATTGTAGCAGG + Intronic
1026604821 7:71806812-71806834 GTTTTTAAGGGGATTGTGGAGGG - Intronic
1028315326 7:89394633-89394655 TTGTTTGAGTAGATTCTGGCTGG + Intergenic
1028409852 7:90517983-90518005 GTTTTTGGCCAGACTGTTGCTGG - Intronic
1028496391 7:91465565-91465587 GTTTTAGTGCTGATTTTGGCAGG - Intergenic
1029586011 7:101471911-101471933 GTTTGTGATCAGGTTGTGACAGG + Intronic
1030038272 7:105426707-105426729 GCTTATGAGAACATTGTGGCTGG + Intergenic
1030292353 7:107885210-107885232 GTTTATGACCAGATTTTGGGGGG + Intergenic
1031409414 7:121423124-121423146 TTTTTTGAACAAATTGTGTCCGG - Intergenic
1032872587 7:136002137-136002159 GTATTTGAGTAGATTGTTGGAGG + Intergenic
1033951992 7:146796368-146796390 GTTTTTAAGGGGATTGTGGAGGG + Intronic
1037960823 8:23096758-23096780 CCTTTTAAGCAGTTTGTGGCAGG + Intronic
1039034685 8:33347109-33347131 GTTTTTGTGCGGATGGTGACAGG - Intergenic
1039635604 8:39161402-39161424 GTTTTTTAGCAGTTTTTGGTGGG + Intronic
1041176630 8:55203577-55203599 GGTTTGAAGAAGATTGTGGCAGG + Intronic
1042225935 8:66514344-66514366 GTTTTTGAACAGATGGGGACAGG - Intronic
1043245260 8:77991382-77991404 GTTTTTTCGGAGATGGTGGCAGG + Intergenic
1043605601 8:81994721-81994743 GTTTTTGAACAAATTTTGGGAGG - Intergenic
1044782093 8:95753497-95753519 GTTTTTTATCAGACAGTGGCAGG - Intergenic
1047071205 8:121345303-121345325 GTTTTTAATCAGATATTGGCAGG + Intergenic
1047269173 8:123338565-123338587 GTTTGTCAGCTCATTGTGGCAGG - Intronic
1047507424 8:125490950-125490972 GTTTTTCTGCTGATTTTGGCTGG - Intergenic
1048486400 8:134851776-134851798 GCTTTTGTGCAAATTATGGCGGG + Intergenic
1048830395 8:138471165-138471187 GATTTGGGGCAGAGTGTGGCTGG + Intronic
1048830412 8:138471329-138471351 GATTTGGGGCAGAGTGTGGCTGG + Intronic
1049395106 8:142396460-142396482 GTTCCAGAGCAGAGTGTGGCAGG - Intronic
1049639685 8:143709397-143709419 GTTTTTAAAGGGATTGTGGCGGG - Intronic
1049985959 9:951685-951707 GTTCTGGAGCAGATTGAGGGAGG + Intronic
1050763789 9:9107526-9107548 GCCTTAGATCAGATTGTGGCAGG + Intronic
1051434288 9:17014299-17014321 ATTTTTGAGATGATTGAGGCTGG - Intergenic
1051517599 9:17948131-17948153 GTTTTTGAGCTTATTGCTGCCGG + Intergenic
1052580637 9:30349899-30349921 GTTTCTGAGCAGAGAGGGGCAGG - Intergenic
1053539624 9:38959751-38959773 GTTTATGACCAGATTTTGGGGGG + Intergenic
1053678577 9:40463859-40463881 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1053928562 9:43092213-43092235 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1054285147 9:63161083-63161105 GTTTTTAAGGGGATTGTGGCGGG - Intergenic
1054291655 9:63299397-63299419 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1054389671 9:64603940-64603962 GTTTTTAAGGGGATTGTGGCGGG + Intergenic
1054506041 9:65912436-65912458 GTTTTTAAGGGGATTGTGGCGGG - Intergenic
1054626517 9:67404167-67404189 GTTTATGACCAGATTTTGGGGGG - Intergenic
1054972336 9:71102997-71103019 GTTTTTGAACAGAATTTGGAGGG + Intronic
1056415253 9:86369141-86369163 GTTTTTAAGGAGATTTTGGAGGG + Intergenic
1056579287 9:87878724-87878746 GTTTTTAAGGAGATTGTGGAGGG - Intergenic
1057205515 9:93169822-93169844 GTTTTTGAGCAGAGAGAGGCTGG + Intergenic
1057820569 9:98327345-98327367 GGTTTTGAGCAGGTGGGGGCAGG - Intronic
1058506448 9:105670845-105670867 GTTTTTAAGCAGTATGTGGGAGG + Intergenic
1058719528 9:107751075-107751097 GTTTTTAACCAGAATTTGGCTGG + Intergenic
1059824421 9:118011616-118011638 GTTGCTGACCAGATTGTGCCTGG + Intergenic
1060405088 9:123369016-123369038 GTTTGTGAGCTGATCGAGGCTGG + Intronic
1061299008 9:129694134-129694156 GTTTTTGAGCACACTCAGGCCGG - Intronic
1061923003 9:133792538-133792560 GTATGTGAGCAGGTTGTGCCGGG + Intronic
1062085801 9:134647563-134647585 GTGTTTGAGGAGCTCGTGGCAGG + Intronic
1185874459 X:3691135-3691157 CCTTTTAAGCAGTTTGTGGCGGG + Intronic
1186087141 X:6002895-6002917 GCTTTGGAGAAGATTCTGGCCGG + Intronic
1186986212 X:15016693-15016715 GGTACTGAGCAGATTGTTGCTGG + Intergenic
1188179792 X:27040479-27040501 GTTTTTAAGCATAATTTGGCGGG - Intergenic
1189014564 X:37083500-37083522 GCTTAAGAGCACATTGTGGCTGG - Intergenic
1189419341 X:40842687-40842709 GCTTGTGATCAGCTTGTGGCTGG + Intergenic
1194053463 X:89101153-89101175 CTTTTTGAGCAGAATATGGGGGG - Intergenic
1195390587 X:104358071-104358093 GTTTTTAAGCGGATTGTGGAGGG + Intergenic
1200970908 Y:9151292-9151314 GTTTTTGGCCAGATTTTGGGGGG + Intergenic
1202140123 Y:21713022-21713044 GTTTTTGGCCAGATTTTGGGGGG - Intergenic