ID: 1090645645

View in Genome Browser
Species Human (GRCh38)
Location 11:128764909-128764931
Sequence CCTGCAGGCGGGTGTCCTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 113}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090645645_1090645652 -3 Left 1090645645 11:128764909-128764931 CCCTAAGGACACCCGCCTGCAGG 0: 1
1: 0
2: 1
3: 10
4: 113
Right 1090645652 11:128764929-128764951 AGGTCCTAGTGCAGAAGCCTGGG 0: 1
1: 0
2: 0
3: 16
4: 162
1090645645_1090645659 24 Left 1090645645 11:128764909-128764931 CCCTAAGGACACCCGCCTGCAGG 0: 1
1: 0
2: 1
3: 10
4: 113
Right 1090645659 11:128764956-128764978 AGGACAGGGCCATTTTCCAGAGG 0: 1
1: 0
2: 2
3: 25
4: 215
1090645645_1090645655 9 Left 1090645645 11:128764909-128764931 CCCTAAGGACACCCGCCTGCAGG 0: 1
1: 0
2: 1
3: 10
4: 113
Right 1090645655 11:128764941-128764963 AGAAGCCTGGGACCGAGGACAGG 0: 1
1: 0
2: 3
3: 12
4: 217
1090645645_1090645654 4 Left 1090645645 11:128764909-128764931 CCCTAAGGACACCCGCCTGCAGG 0: 1
1: 0
2: 1
3: 10
4: 113
Right 1090645654 11:128764936-128764958 AGTGCAGAAGCCTGGGACCGAGG 0: 1
1: 0
2: 4
3: 8
4: 234
1090645645_1090645651 -4 Left 1090645645 11:128764909-128764931 CCCTAAGGACACCCGCCTGCAGG 0: 1
1: 0
2: 1
3: 10
4: 113
Right 1090645651 11:128764928-128764950 CAGGTCCTAGTGCAGAAGCCTGG 0: 1
1: 0
2: 2
3: 39
4: 168
1090645645_1090645656 10 Left 1090645645 11:128764909-128764931 CCCTAAGGACACCCGCCTGCAGG 0: 1
1: 0
2: 1
3: 10
4: 113
Right 1090645656 11:128764942-128764964 GAAGCCTGGGACCGAGGACAGGG 0: 1
1: 0
2: 1
3: 23
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090645645 Original CRISPR CCTGCAGGCGGGTGTCCTTA GGG (reversed) Intronic