ID: 1090645901

View in Genome Browser
Species Human (GRCh38)
Location 11:128766601-128766623
Sequence TCAGGCCTCCCCGCCCTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 417
Summary {0: 1, 1: 0, 2: 5, 3: 34, 4: 377}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090645899_1090645901 26 Left 1090645899 11:128766552-128766574 CCTTTCAGATTAAGAAACAAATT 0: 1
1: 0
2: 9
3: 72
4: 507
Right 1090645901 11:128766601-128766623 TCAGGCCTCCCCGCCCTGCCTGG 0: 1
1: 0
2: 5
3: 34
4: 377

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090645901 Original CRISPR TCAGGCCTCCCCGCCCTGCC TGG Intronic
900122329 1:1054169-1054191 AAAGGCATCCCGGCCCTGCCCGG + Intronic
900142496 1:1144577-1144599 CCAGCGCTCCCCTCCCTGCCAGG + Intergenic
900151851 1:1182340-1182362 TCCTGCCTCCCTGCCCTGCAGGG + Exonic
900177144 1:1295920-1295942 CCAGGCCTCCTTGTCCTGCCTGG + Exonic
900330958 1:2134127-2134149 TCAGCCCACCCAGCCCTCCCAGG - Intronic
900342636 1:2195956-2195978 CCAGGCCCCCTCCCCCTGCCCGG - Intronic
900385131 1:2407086-2407108 TCAGGCCTCTCCGTCATGCTAGG - Intronic
900431281 1:2604297-2604319 TGAGGCCACCCAGCTCTGCCCGG - Intronic
900606202 1:3524664-3524686 TCAGGCTTCCCCCCACAGCCTGG - Intronic
900621687 1:3590485-3590507 TGAGGCCCCACCGCCCCGCCCGG + Intronic
900917005 1:5646192-5646214 CCAGGTCTCCCTCCCCTGCCAGG + Intergenic
900950962 1:5858180-5858202 TCAGGCCACCCCACCCTGGGCGG + Intergenic
901808101 1:11750384-11750406 TGAGGCCTCCCCTCCCTTCAGGG + Exonic
902540253 1:17149407-17149429 CCAGGTCTCCACGCGCTGCCCGG + Intergenic
902561056 1:17277773-17277795 TCAGTCGTCCCTGCCCTGCAAGG + Intronic
904597950 1:31658513-31658535 GCAGGCCTCCCAGGCCAGCCCGG - Exonic
906199055 1:43947566-43947588 TCAGGGCCCACCTCCCTGCCAGG + Exonic
910691910 1:89974004-89974026 ACAGGCCACCGCGCCCGGCCGGG - Intergenic
912419955 1:109536126-109536148 TCTGGCCTACACCCCCTGCCAGG - Intergenic
914920950 1:151847196-151847218 TCCTGCCTCCCCTGCCTGCCTGG - Intergenic
915082610 1:153362327-153362349 TCAGCCCTCCCCTCACAGCCTGG + Intergenic
915898957 1:159832928-159832950 TCAGCCCTCCAAGACCTGCCAGG + Exonic
916574264 1:166053050-166053072 TCAGCCATCCCCACCCAGCCTGG - Intergenic
916683158 1:167122261-167122283 CCAGGCCTGCCCGGCGTGCCAGG - Intronic
917807389 1:178625898-178625920 AAAGGCCTCCCCATCCTGCCTGG - Intergenic
919808982 1:201397363-201397385 CCTGGCCTGCCCTCCCTGCCGGG - Intronic
920099629 1:203508739-203508761 GCAGGCCTCCTCCCCCTGCATGG - Exonic
920205264 1:204286697-204286719 TGAAGCCCCCCTGCCCTGCCTGG + Intronic
920301585 1:204992273-204992295 TCAGCCCTCCCTCCACTGCCTGG - Intronic
920957640 1:210633738-210633760 TCAGCTCTGCCTGCCCTGCCCGG - Intronic
921673416 1:217951210-217951232 TCTGACCCCCCCACCCTGCCAGG - Intergenic
922167620 1:223129098-223129120 TCATGCCTCCCCACCATTCCAGG + Intronic
922502711 1:226109132-226109154 TCTGGCCTCCCTGCTCTTCCGGG + Intergenic
922740854 1:228013570-228013592 CCAGGCTGCCCAGCCCTGCCTGG - Intronic
922895204 1:229094642-229094664 ACAGGCCTGCCCACCCTGCCGGG + Intergenic
1062940559 10:1417735-1417757 TCTGGACTCAGCGCCCTGCCTGG + Intronic
1063956308 10:11270785-11270807 TCAGTCCGCCCAGCCCTGTCAGG - Exonic
1065434663 10:25694410-25694432 ACAGGCCTCCCAGCATTGCCTGG - Intergenic
1065882168 10:30046264-30046286 TCAGGGCTCCTCTCCCAGCCTGG + Intronic
1066510244 10:36087508-36087530 TCAGGCTTCCCCAGCCTGCGTGG - Intergenic
1067053245 10:43037218-43037240 TCTGGGCTGCACGCCCTGCCTGG + Intergenic
1067059391 10:43070255-43070277 CCAGGGCTTCCCGCCATGCCTGG - Intergenic
1067251138 10:44587931-44587953 TGCTGCCTCCCCGCCCTCCCTGG + Intergenic
1068169587 10:53376062-53376084 TCCGGCCTCCCAACCCTGGCAGG - Intergenic
1070745276 10:78930024-78930046 TGAGGCCTCCCTGCCCAGCTGGG + Intergenic
1071086605 10:81874449-81874471 TCACGCCCCGGCGCCCTGCCCGG - Intergenic
1072491174 10:95907557-95907579 TCGCGCCTCCACGCCCTGCGCGG + Intronic
1073321670 10:102619670-102619692 CCAGCCCTCCTCCCCCTGCCAGG + Intronic
1075490040 10:122858845-122858867 TCAGGGCACCCCACCCTCCCTGG + Intronic
1075726291 10:124612555-124612577 AGAGGCCTCCGGGCCCTGCCAGG - Intronic
1075875489 10:125802744-125802766 TCAGACCTACCCTCCCTACCTGG - Intronic
1076550103 10:131272763-131272785 TCAGTGCTGCCCACCCTGCCGGG + Intronic
1076889418 10:133276569-133276591 TCCGACCTCCCCGGCCTCCCCGG + Intronic
1077105285 11:839517-839539 TAAGGCCTGCCCTCCCTGCTGGG + Intronic
1077530676 11:3093401-3093423 CCAGGCCTGCCCTCCCTGCCAGG + Intronic
1080384847 11:31805201-31805223 TCAGGGCTGCGCGCCCTGGCTGG + Intronic
1081581471 11:44355192-44355214 TGAATCCTCCCAGCCCTGCCAGG - Intergenic
1081713725 11:45234088-45234110 CCAGACATCCCCGCCCGGCCCGG - Intronic
1081841162 11:46202412-46202434 TCAGCCCTCCAAGCCCTGCATGG + Intergenic
1083271463 11:61574979-61575001 TCATGCCACCCTGCCCTGGCTGG + Intronic
1083375150 11:62214344-62214366 GCAGGCCTCCCCTCCCTGGCTGG - Intergenic
1083384386 11:62296782-62296804 GAAGCCCTCCCTGCCCTGCCTGG - Intronic
1083677426 11:64334167-64334189 TCATGCCTCAGCTCCCTGCCTGG + Intergenic
1083682802 11:64359089-64359111 TCCCGGCTCCCCGCCCTGCGCGG - Intergenic
1083719981 11:64599248-64599270 TAAGCCCTCTCCGCCCTCCCTGG - Intronic
1083747827 11:64745152-64745174 CCAGTGCCCCCCGCCCTGCCTGG + Intronic
1083770473 11:64864220-64864242 TCGGGCCTCCCCGTCCAGGCTGG - Intronic
1083828734 11:65217710-65217732 TCAGGAGCCCCCGCCCTTCCTGG - Intergenic
1084226202 11:67716060-67716082 TCAGCCCTCCCCGCATTGCGGGG + Intergenic
1084751090 11:71204873-71204895 CCAGGCGTCCCTTCCCTGCCCGG - Intronic
1086981023 11:93197903-93197925 CCAGGCCTACCTCCCCTGCCCGG + Exonic
1088706358 11:112467793-112467815 TCAGGCCTCCCTTCCCTGTGAGG - Intergenic
1089660274 11:119981135-119981157 TCTGCCCTCCCAGCCCTGCAGGG + Intergenic
1090095881 11:123741460-123741482 CCCCTCCTCCCCGCCCTGCCCGG + Intronic
1090260530 11:125315597-125315619 TCAGCCCTCCCAGCCCTGCAAGG - Intronic
1090645901 11:128766601-128766623 TCAGGCCTCCCCGCCCTGCCTGG + Intronic
1091558254 12:1592571-1592593 TCAGTCCTCCACCCCCTGCAGGG + Intronic
1092208747 12:6632814-6632836 GGAGGCCTCCCCGCCCACCCTGG - Intronic
1093216104 12:16362806-16362828 ACAGGCCTCACCACCATGCCTGG - Intronic
1094480172 12:30875170-30875192 CCAGCCCTCCCCTCCCTGCCTGG - Intergenic
1096547554 12:52351047-52351069 TCTAGCCTCCCCGCCCTGAAGGG - Intergenic
1100318533 12:93467653-93467675 GCAGGCAACCTCGCCCTGCCGGG - Intronic
1102963916 12:117111886-117111908 TGAGGCCCCCCAGCCCTGCCTGG + Intergenic
1103176210 12:118865637-118865659 TGAGGCATCCCATCCCTGCCTGG - Intergenic
1103445624 12:120993527-120993549 TCAGCCCTCCCTGCCCTGCATGG - Exonic
1103601467 12:122057281-122057303 TCTGGCCTCCCCGGCCACCCTGG - Intronic
1104476353 12:129073712-129073734 CCAGGCCTCGCCGCCGAGCCGGG + Exonic
1104691559 12:130829954-130829976 TCACACCTCCCTGCTCTGCCAGG + Intronic
1104854663 12:131896069-131896091 ACAGGCATCCCCTCCCCGCCGGG + Intronic
1104940283 12:132391982-132392004 TCCGGCCACCCCGCTCTCCCTGG + Intergenic
1108689316 13:52847508-52847530 TCAGGCCGCCTCACCCTGGCCGG - Exonic
1109816749 13:67594310-67594332 CCAGGCCCCCACGCCCTGACAGG - Intergenic
1109875250 13:68394351-68394373 CCTGGCCTGCCTGCCCTGCCTGG - Intergenic
1110819086 13:79893072-79893094 CCAGGCCTCCACCCCCTGACAGG - Intergenic
1113771078 13:112909348-112909370 CCCGGCCTCCCCGCCCAGCATGG + Intronic
1113808298 13:113122644-113122666 TCTGGCCGCCCAGCTCTGCCTGG + Intergenic
1113816612 13:113176009-113176031 ACAAGCTTCCCCGCCCAGCCCGG + Intergenic
1114272430 14:21109834-21109856 TCAGTCCTCCCCACCCTTCTTGG - Intergenic
1114671428 14:24413426-24413448 TCAGACCTCCCCAGCCTCCCAGG + Intronic
1114835383 14:26197440-26197462 TCAAGTCTCCCGGCCCGGCCCGG - Intergenic
1117157026 14:52951247-52951269 CCACGCCGCCCCGCCCCGCCCGG - Intronic
1117495070 14:56294617-56294639 TCAGTCCTCTCTGCCCTCCCTGG + Intronic
1118348807 14:64959067-64959089 TCAGTCCCCACTGCCCTGCCTGG - Intronic
1119432162 14:74575560-74575582 GCAGGCGTCCCTCCCCTGCCTGG + Intronic
1120862307 14:89265906-89265928 TCAGGCATTCCCACCCTACCAGG - Intronic
1121112204 14:91320235-91320257 TCAGGCCTCCCCTACCTCCAGGG + Intronic
1121316070 14:92961673-92961695 TCAGTCCGGCCCGCCCTGCAGGG - Intronic
1122066815 14:99179597-99179619 TCAGGGCCACCCGTCCTGCCTGG + Intronic
1122118126 14:99537670-99537692 CCCAGCCTCCCCGCCCTGCCAGG + Intronic
1122235553 14:100329062-100329084 TCTGGGCTCCCCGCCCTGCCAGG - Intronic
1122249462 14:100427801-100427823 TCTGGCCTCCTGTCCCTGCCTGG - Intronic
1122938870 14:104972381-104972403 TCAGCCAGCCCTGCCCTGCCTGG - Intronic
1122961126 14:105093982-105094004 CCAGCCTTCCCCGCCCTGCCGGG - Intergenic
1123110998 14:105866782-105866804 TCAGGGTCCCCCGTCCTGCCTGG - Intergenic
1123111315 14:105868245-105868267 TGAGGCCTGCCATCCCTGCCAGG - Intergenic
1124416972 15:29480481-29480503 TGTGGCCTCCCTGCCCTACCAGG - Intronic
1124715071 15:32052118-32052140 TCAGGGCTCCCCTCTCTTCCTGG + Intronic
1128511628 15:68317142-68317164 TCAGGCCTCCCATCCCTCCCTGG + Intronic
1129190639 15:73935577-73935599 TGAGCCCTCCCCGCCCTTGCAGG - Intronic
1129692003 15:77719065-77719087 TCTGGACCCTCCGCCCTGCCTGG - Intronic
1132285475 15:100659076-100659098 GCCGGCATCCCCACCCTGCCCGG - Intergenic
1132498765 16:275701-275723 CCAGGCCTCGCCGCCCCTCCCGG + Intronic
1132851371 16:2026483-2026505 ACAGCCCTCCCCACCCTCCCCGG - Intronic
1132877462 16:2146792-2146814 TCAAGGCTCCCCTCCCCGCCTGG + Intronic
1133213107 16:4273783-4273805 TCCACCCTCCCCTCCCTGCCGGG - Intergenic
1133250403 16:4476754-4476776 TCAGGCCTCCCCGCGCCCCCGGG - Intronic
1134653920 16:15932165-15932187 ACAGGGCTCCCCGCCCCACCCGG - Intergenic
1136570580 16:31094276-31094298 TCCTGCCTCCCCGCCTTTCCTGG + Intronic
1136588342 16:31202123-31202145 TGAGGCCTCCACACCCAGCCCGG - Intronic
1139544817 16:67645221-67645243 TTGGGCCTCCCCGGCCCGCCCGG + Exonic
1139775084 16:69311725-69311747 TCAGGCCTTCCGGCCCTGCCCGG + Intronic
1141028572 16:80569561-80569583 TCAGGCATCCCCGCACTCCTGGG + Intergenic
1141476961 16:84280526-84280548 TGAGGCTTCCCTTCCCTGCCAGG + Intergenic
1141538530 16:84700178-84700200 GCGGGCGTCCGCGCCCTGCCCGG + Intronic
1141842315 16:86580995-86581017 TCTTCCCTCCCAGCCCTGCCAGG + Exonic
1141910752 16:87056935-87056957 TCAGGCCTCCCAGGCCTCCCAGG + Intergenic
1142160093 16:88552864-88552886 TCAGGGCTGCCCTCCCTGCAGGG - Intergenic
1143203574 17:5128484-5128506 TCAGCCCTCCCCGCCCAGGGTGG - Intronic
1145258726 17:21342263-21342285 TCTGGGCTCCAGGCCCTGCCGGG + Intergenic
1145317903 17:21745741-21745763 TCTGGGCTCCAGGCCCTGCCGGG - Intergenic
1145759401 17:27417645-27417667 TCAGCCCTCCCCGCCCAGGGTGG - Intergenic
1146190563 17:30761804-30761826 ACAGGCGTCCCCACCATGCCTGG + Intergenic
1146845011 17:36176908-36176930 TCAGCCCTCCCCGCCCAGGGTGG + Intronic
1146857318 17:36264843-36264865 TCAGCCCTCCCCGCCCAGGGTGG + Intronic
1146880586 17:36439839-36439861 TCAGCCCTCCCCGCCCAGGGTGG + Intergenic
1147076112 17:37989378-37989400 TCAGCCCTCCCCGCCCAGGGTGG + Intronic
1147077691 17:38003681-38003703 TCAGCCCTCCCCGCCCAGGGTGG - Intronic
1147087637 17:38068924-38068946 TCAGCCCTCCCCGCCCAGGGTGG + Intergenic
1147103579 17:38192873-38192895 TCAGCCCTCCCCGCCCAGGGTGG + Intergenic
1147307487 17:39573884-39573906 TCCTCCATCCCCGCCCTGCCTGG - Intergenic
1147445780 17:40474532-40474554 CCAGCCCTCCCACCCCTGCCGGG + Intergenic
1147535894 17:41323240-41323262 TCAGCCCTCCCCACCCAGCATGG - Intergenic
1148340821 17:46872517-46872539 TCAGGACTTCCCGCCCGGTCAGG - Exonic
1148680347 17:49470164-49470186 GCAGCACTCCCCACCCTGCCAGG + Intronic
1148685249 17:49497158-49497180 TCAACCCCCCCCGCCCTGCTGGG - Intronic
1148716614 17:49720328-49720350 TCAGTGCTCCCCGCACTGCGTGG + Exonic
1149862017 17:60127154-60127176 TCAGCCCTCCCCGCCCAGGGTGG - Intergenic
1151306042 17:73263207-73263229 TCAGTCCTGCCTGCGCTGCCAGG - Intergenic
1151402158 17:73862820-73862842 TCAGGCCCCCACGCCCAGCTAGG - Intergenic
1151696490 17:75720951-75720973 TCAGGCCTCCCGACCGGGCCGGG + Intergenic
1151724064 17:75874653-75874675 GAAGGCCTCCCGGCCCCGCCGGG - Exonic
1152245709 17:79183558-79183580 TCCAGCCTCCCCGCCCGGGCAGG - Intronic
1152281105 17:79385273-79385295 TGCAGCCTCCCCGCCCTGCTGGG - Intronic
1152407769 17:80107445-80107467 CCAGGCCACTCCGCCCTCCCAGG + Intergenic
1152597528 17:81245200-81245222 TCAGGCCTCCTGCTCCTGCCAGG - Exonic
1152604661 17:81283066-81283088 TCAGGCATCCCCGGCCTCCATGG - Intronic
1152641708 17:81452113-81452135 CCAGGCCCCCCCGCCACGCCAGG - Intronic
1152685895 17:81693758-81693780 TGAGGCCGCCCCGCCCCACCCGG - Intronic
1152694840 17:81738899-81738921 CCCGTCCTCCCCGTCCTGCCAGG + Intergenic
1152779267 17:82219201-82219223 CCCGGCCTCCAGGCCCTGCCTGG - Intergenic
1154167513 18:12027153-12027175 TCAGGCCTCACTGCCCGGGCAGG - Intronic
1154202498 18:12308804-12308826 CAAGGCCGCCGCGCCCTGCCCGG + Intronic
1156495039 18:37520066-37520088 CTAGGCCTCCCCGCCTTGCTTGG - Intronic
1157365248 18:47058630-47058652 CCAGGCCTTCCCGCTCTGACTGG - Intronic
1157564775 18:48672621-48672643 GCTGGCCTCCCCTCCCTACCTGG + Intronic
1157630571 18:49091372-49091394 TCATGCCTGCCCGACCTTCCAGG - Intronic
1160025080 18:75209688-75209710 CAGGGGCTCCCCGCCCTGCCCGG - Intergenic
1160387493 18:78505360-78505382 CCCTGCCTCCCCGCCCTGCTGGG - Intergenic
1160706525 19:532531-532553 GCTGCCCTCCCCGCCCTCCCCGG + Intronic
1160756765 19:761577-761599 CCAGGCCTTTCTGCCCTGCCCGG - Intronic
1160843419 19:1156331-1156353 CCAGGTCTCCACACCCTGCCAGG - Intronic
1160870691 19:1276409-1276431 TCAGGCCACCCCGGCTTCCCTGG + Intronic
1161270713 19:3387924-3387946 CCAGGCCTCCCCGCCCCCTCTGG + Intronic
1161286793 19:3472432-3472454 ACAGCCCTCCCCTCCCAGCCAGG - Intergenic
1161589027 19:5120466-5120488 TCGGGCCTCCCCACTCTCCCGGG + Intronic
1161595664 19:5149935-5149957 TCCGGCCTCCCCTGCCTCCCAGG + Intronic
1162228381 19:9243853-9243875 TAAGGCCTCCCCTCCTTCCCTGG - Intergenic
1162758293 19:12873539-12873561 CCAGGCCACCCCGCGCTGCTCGG - Intronic
1163517393 19:17773465-17773487 TCAGGTCTCCCCTCCCTGCATGG + Intronic
1163644001 19:18478116-18478138 TCAGGCGTCCCCACCAGGCCAGG - Intronic
1165062283 19:33210760-33210782 CCCTGCCTCCACGCCCTGCCTGG + Intronic
1165614121 19:37183565-37183587 ACAGGCCTTCCCTGCCTGCCTGG - Exonic
1166364304 19:42270678-42270700 GCATGCATCCCCGCCCTGGCTGG - Intronic
1167508418 19:49883085-49883107 TCAGGAGGCCCTGCCCTGCCAGG + Intronic
1167644017 19:50696008-50696030 TCCTGCCTCCCCGCTCTTCCCGG - Intronic
1167648824 19:50719081-50719103 ACCCGCCTCCCCGCCCAGCCCGG - Intronic
1168210844 19:54888918-54888940 TCACGCCACCACGCCCGGCCAGG - Intronic
1168347030 19:55654939-55654961 GCAGCCCTCCCCGCCCCGCCCGG - Intronic
1168409110 19:56127525-56127547 TCAGAACTCCCACCCCTGCCCGG - Intergenic
1168642256 19:58038230-58038252 TCAGGCCCCCTGGCCCGGCCCGG - Intronic
926348970 2:11978005-11978027 TCAGACCTCCCAGGCCAGCCTGG - Intergenic
928149084 2:28810503-28810525 TGCGGCCTCCCCTCCCCGCCCGG - Intronic
928175163 2:29028422-29028444 TCCAGCAGCCCCGCCCTGCCTGG + Intronic
929606816 2:43240244-43240266 CCAGGCCACCCCAGCCTGCCTGG - Intronic
929775756 2:44929638-44929660 TCAGGCCTCCGCGGCCGCCCGGG + Intergenic
929927841 2:46230289-46230311 GCAGGCCTCCCCGCCAAGGCAGG + Intergenic
931652232 2:64479081-64479103 CCACACCTCCCCGCCCTTCCTGG + Intergenic
932551526 2:72774894-72774916 TGATGCCTCCCCTCCCTACCAGG + Intronic
932579542 2:72984509-72984531 CCAGGCCTCCCAGGCCTCCCAGG - Intronic
933684572 2:85133346-85133368 TCCGGCCCCCCTGCCCAGCCCGG + Intergenic
933778439 2:85785771-85785793 TCAGGCACCTCCGACCTGCCAGG - Intronic
934119173 2:88823729-88823751 TCAGCCCTGGCCACCCTGCCTGG - Intergenic
934515838 2:94985868-94985890 TCAGCCCTGGCCACCCTGCCTGG + Intergenic
935593548 2:104862615-104862637 TCTGGCCGCCCGGCCGTGCCGGG - Intergenic
935999751 2:108815759-108815781 TCAAACCTCCCCAACCTGCCTGG - Intronic
937929455 2:127193075-127193097 TTTGGCCTCCACGCCCTACCTGG + Exonic
937954566 2:127414877-127414899 TCTGTCCTCCCTGCCCTGCCTGG + Intergenic
938038687 2:128057545-128057567 TCATGCTTCCCGGCCCTGCGTGG - Intergenic
938238143 2:129722874-129722896 CCGCACCTCCCCGCCCTGCCTGG - Intergenic
942315671 2:174694302-174694324 CCAGCCCTCCCTGCCCTTCCAGG - Intergenic
943912325 2:193584475-193584497 TCAGGCTGCCCCTCCCTTCCTGG + Intergenic
946092848 2:217246136-217246158 TCCGGCCTCCCCTCCCTACCAGG + Intergenic
946226276 2:218265634-218265656 TGTGGCCTCCCAGCCCAGCCTGG - Exonic
946409066 2:219507494-219507516 TCAGGCCCACCCAGCCTGCCAGG - Intergenic
947375225 2:229489107-229489129 TCTGGCCTCCCGGCCCAGCTGGG + Intronic
948831139 2:240598789-240598811 GCCTGCCTCCCAGCCCTGCCAGG + Exonic
949043166 2:241858675-241858697 TCAGCACCCCCCGACCTGCCAGG + Intronic
1168780167 20:482536-482558 TAAGGCCTCTCTGCTCTGCCCGG + Exonic
1169082236 20:2804804-2804826 TCTGTCCCACCCGCCCTGCCAGG - Intergenic
1169084293 20:2817098-2817120 TCAGGGCTCCCTGCCTTGGCAGG + Intronic
1170960431 20:21020519-21020541 TCAGGGCTGCCGGCCCTGCGAGG + Intergenic
1171384846 20:24763205-24763227 CCAGCCCACCCAGCCCTGCCTGG + Intergenic
1172117828 20:32582857-32582879 TCAGCCCTCCCCACCCTGCCAGG - Intronic
1172184109 20:33020705-33020727 TCAGGCTTCCCCGGGCTGCTTGG + Intronic
1172295913 20:33811277-33811299 ACAGGCCCCCACGCCCGGCCCGG - Intergenic
1172484510 20:35290328-35290350 TCCTGCCTCTCGGCCCTGCCTGG - Intronic
1172905557 20:38366629-38366651 ACAGGCATCTCCTCCCTGCCAGG + Intronic
1173222576 20:41141745-41141767 CCAGGCCCCCCCGCCCAGCTGGG + Intronic
1173556464 20:43969645-43969667 ACAGGCCTCCCCGCCCACTCAGG + Intronic
1175333617 20:58180860-58180882 TCAGGCCTCCCCACCAGGCAAGG + Intergenic
1175914838 20:62420988-62421010 TCACTCCGCCCAGCCCTGCCTGG - Intronic
1175916415 20:62428100-62428122 CCAGCCTGCCCCGCCCTGCCTGG + Intergenic
1175998605 20:62822117-62822139 TCTGGACTCCCCGGCCTCCCTGG + Exonic
1176016873 20:62938304-62938326 TCCCGCCTGCCCGCCCGGCCCGG - Intronic
1176076693 20:63251878-63251900 TCAGGCCTCCCCATCGTGCCCGG + Intronic
1176142797 20:63552707-63552729 TCTGCCCTGCCCTCCCTGCCTGG - Intronic
1179586080 21:42375128-42375150 TCAGGTTTCCCCTCCATGCCCGG + Intronic
1180064455 21:45405514-45405536 GCCGGCCTCGCCGCCCTGGCTGG + Intronic
1180132695 21:45836416-45836438 TCATGCCTTCCTGCCCTGCTGGG + Intronic
1180172649 21:46067820-46067842 ACCGGCCTCTCCTCCCTGCCAGG + Intergenic
1181473402 22:23154306-23154328 TCAATCCTCCATGCCCTGCCTGG + Intronic
1181634761 22:24169422-24169444 TCAGGCCCCCACCACCTGCCTGG + Intronic
1181988733 22:26820554-26820576 TCTGGGCTCCCCCCCCAGCCAGG + Intergenic
1181996567 22:26887417-26887439 ACAGGGCTCCCCGCCCCACCCGG - Intergenic
1182098638 22:27642447-27642469 GCAGGCCTCCCTCGCCTGCCTGG + Intergenic
1182256028 22:29039212-29039234 TCAGGCTTCCCTGCTCCGCCCGG - Intronic
1182486215 22:30640663-30640685 CCAGGCCTCCCCACCCTGAGTGG - Intronic
1182749754 22:32632162-32632184 CCAGGGCTCCACACCCTGCCTGG - Intronic
1183413852 22:37671582-37671604 TCGGTCATTCCCGCCCTGCCAGG - Intergenic
1183813832 22:40281926-40281948 TCATGCCTCCTCACCTTGCCAGG + Intronic
1183931306 22:41237646-41237668 TCAGGCGGCCCAGCCCGGCCAGG + Exonic
1183951311 22:41354590-41354612 TCAAGCCTCCCCGTCTTCCCAGG - Intronic
1184202042 22:42976486-42976508 GCAGGCCTCCCTGTCATGCCTGG + Intronic
1184438742 22:44496305-44496327 AGATGCCTCCCAGCCCTGCCAGG - Exonic
1184554732 22:45227038-45227060 TCACTCCTCCACTCCCTGCCCGG + Intronic
1184597743 22:45524456-45524478 CCACACCTCCCAGCCCTGCCGGG - Intronic
1184851835 22:47125356-47125378 TCAGGCCTCCCTGCTCCCCCAGG - Intronic
1184852788 22:47130303-47130325 TCAGGACACCCCCTCCTGCCGGG + Intronic
1185281660 22:49972356-49972378 TCAGGCAGCCGCACCCTGCCTGG + Intergenic
1185296823 22:50058636-50058658 CCAGGCCTTCTCGCCCTCCCCGG + Intergenic
1185344707 22:50306221-50306243 TCAGGCCTCCCAGACCCCCCGGG + Intronic
950482668 3:13254320-13254342 TCAGGCCTCCGTGTCCAGCCTGG - Intergenic
951555671 3:23917969-23917991 ACAGGGCTCCCCGCCCCACCCGG + Exonic
952677833 3:36054159-36054181 TCTTGACTCCCAGCCCTGCCTGG + Intergenic
954032641 3:47830733-47830755 GCAGGCCTCGCCACCATGCCTGG + Intronic
956129476 3:66039725-66039747 GCAGGCTTCTCGGCCCTGCCAGG - Intergenic
957288448 3:78246856-78246878 TCTCTCCTCCCCTCCCTGCCAGG + Intergenic
958963488 3:100533593-100533615 TCAGGCTCCCCTGCCCTGCCTGG - Intronic
960141328 3:114154410-114154432 TCAGGCCTTCCCACCCAGGCTGG - Intronic
960841358 3:121962804-121962826 GCAGGCCACCCCTCCCTGCTAGG - Intergenic
961455599 3:127022443-127022465 TGAGTCCTCCCACCCCTGCCCGG - Intronic
961468855 3:127098848-127098870 CCTGGCCTCCCCTCCCTGCCTGG + Intergenic
961530060 3:127535235-127535257 TCAGGCCTCCCCCTGCTGCGAGG + Intergenic
962290785 3:134134712-134134734 TCAGGACCCCCAGCCCTCCCTGG - Intronic
962443044 3:135440390-135440412 CCTGGCCTCCTAGCCCTGCCAGG + Intergenic
966273194 3:178133747-178133769 TCAGGCCTCACCTCCGTGACTGG - Intergenic
967932796 3:194702641-194702663 TCCGGTCTACCCGCCCTCCCCGG - Intergenic
968189873 3:196660019-196660041 GCCGCCCTCCACGCCCTGCCGGG + Exonic
968513418 4:1005097-1005119 CCAGGACGCCCAGCCCTGCCTGG - Intergenic
968556142 4:1247452-1247474 CCAGGTCTCCCCTGCCTGCCCGG - Intronic
968704349 4:2071032-2071054 TCAGGCCACCCCCCCCCCCCCGG - Intergenic
968730697 4:2267980-2268002 CCAGGCCTCCCTGCGCTGCCCGG - Intergenic
968831146 4:2933625-2933647 CCAGTCCACCCCGCCCTGCCAGG + Exonic
968940484 4:3634945-3634967 TCAGGCCACCCTGCCCTGCCAGG + Intergenic
969288357 4:6222303-6222325 TCGGGCCTGCCCCCCCGGCCTGG + Intergenic
973219184 4:47706481-47706503 ACAGGGCTCCCCGCCCCACCCGG + Intronic
973849197 4:54944771-54944793 TCAGCTCTCCCAGCCCAGCCAGG - Intergenic
975614592 4:76234117-76234139 TCCACCCTCCCCTCCCTGCCTGG - Intronic
983577160 4:169271453-169271475 CCAGGGCTCCCAGCCCCGCCGGG - Intergenic
984760538 4:183359301-183359323 TCAGGCATCCCAGACCAGCCTGG + Intergenic
985652184 5:1112329-1112351 CCCGCCCTCCCCGCCCTCCCCGG + Intergenic
988482149 5:31639569-31639591 TCCTCACTCCCCGCCCTGCCAGG - Intronic
989205934 5:38809179-38809201 GCAGCCCTCGCCGCCCCGCCCGG + Intergenic
990299647 5:54437600-54437622 TCACCCCGCCCCACCCTGCCAGG + Intergenic
991118502 5:62982666-62982688 TCAAGCTTCCCAGCCCTACCAGG + Intergenic
992940105 5:81752043-81752065 CCAGGCTTCCCCACCCGGCCTGG + Intergenic
993899215 5:93572953-93572975 TCCAGCCTCGCCGCCCTGCGCGG - Intergenic
995805380 5:116046550-116046572 TGAGGCCTCCACACCTTGCCAGG + Intronic
996878222 5:128263348-128263370 TCAGGCCACCCCCCACTGCAGGG - Intronic
997297545 5:132777326-132777348 ACCGGCCTCCCCGCCCGGCCCGG + Exonic
997299156 5:132789754-132789776 GCAGGCCTCCCAGAGCTGCCTGG + Intronic
997513137 5:134466593-134466615 CCAGGACACCCCGCCCTGCCCGG + Intergenic
999253984 5:150199373-150199395 TCAGGCCTCCGGGGCCTCCCAGG - Intronic
1002329390 5:178431036-178431058 TCTGGTCTCCCTCCCCTGCCTGG - Intronic
1002447264 5:179297322-179297344 CCCGGCCTCCCCTGCCTGCCTGG + Intronic
1003624058 6:7726941-7726963 CCCGGCATCCCCGCCCGGCCGGG - Exonic
1004044399 6:12011635-12011657 TCGCCCCTCCCCGCCCCGCCCGG - Intronic
1004092093 6:12514219-12514241 ACAGGGCTCCCCGCCCCACCCGG + Intergenic
1004364586 6:15001038-15001060 TGAGCCCTCCCCGCCCGGCCCGG + Intergenic
1005445026 6:25914037-25914059 TCAGTCCTTCCATCCCTGCCTGG + Intronic
1005512160 6:26520932-26520954 GCAGCCCTCCCCGCGCAGCCTGG + Intergenic
1005649458 6:27873378-27873400 TAACGCCTCCACGCCGTGCCAGG + Exonic
1005823949 6:29621049-29621071 TCAGTCCTCTCCACCCTCCCAGG + Intronic
1006147050 6:31965917-31965939 CCAGGCCCCTCCGCCCTGCCCGG - Exonic
1006297624 6:33177008-33177030 CCAGGGCTCCCCGGCATGCCTGG - Exonic
1006332765 6:33404179-33404201 TCATGCCTCCCCTCCCTTCCAGG + Intronic
1006398514 6:33802290-33802312 CCCGGCCTCCCCTCCCTGCTTGG - Intronic
1006576091 6:35047544-35047566 TCACCCCTCCCCACCATGCCTGG + Intronic
1006679456 6:35786932-35786954 TCCGCCCTCGCCGCCCCGCCTGG - Intronic
1007719836 6:43878399-43878421 TCCGGAGTCCCCGTCCTGCCTGG - Intergenic
1007775841 6:44223853-44223875 CCAGGCCGCCCCGCCCAGCTTGG - Exonic
1009289778 6:61868323-61868345 GCAGACCTCCCCTCCCTGCCAGG + Intronic
1010926828 6:81753910-81753932 TCAGCCCTGCCCGCCCAGACTGG + Intergenic
1011785382 6:90837742-90837764 TCAGGCCTTCACACCTTGCCTGG + Intergenic
1012410184 6:98947851-98947873 CCAGGCCTTCTCGCGCTGCCTGG - Exonic
1012465861 6:99515527-99515549 TCACCCCTCCCCGCGCTCCCGGG - Intronic
1012832285 6:104219306-104219328 TCAGCCCTCCACCCCCTGACAGG - Intergenic
1016738556 6:147506833-147506855 GCAGCCCTCCCCGCCCCGCGCGG - Intergenic
1017012491 6:150072021-150072043 ACAGGCATCCCCACCATGCCCGG + Intergenic
1018089008 6:160329495-160329517 ACAGGCCTCCCCACCATGGCGGG - Intergenic
1018635274 6:165854801-165854823 ACGGGCCGCCCTGCCCTGCCTGG - Intronic
1018869322 6:167769159-167769181 TCAGCCCTCCCAGCCCTGCGTGG - Intergenic
1019179194 6:170176396-170176418 CCAGGCGCCCCCGCCCTTCCAGG - Intergenic
1019896569 7:3987919-3987941 TCACGCCTCTCCGCTCTCCCTGG + Intronic
1022009167 7:26293413-26293435 TCAGGACTTCCAGACCTGCCTGG - Intronic
1022477794 7:30723118-30723140 TCAGTCCTCCCTGCCCTGTCTGG - Intronic
1023860269 7:44214101-44214123 TCAAGCCAGCCCGCCCTGCAAGG - Exonic
1025217351 7:57070023-57070045 TGAGGGCTGCCCGCCCTCCCAGG - Intergenic
1025628268 7:63243676-63243698 TGAGGGCTGCCCGCCCTCCCAGG - Intergenic
1025653997 7:63500442-63500464 TGAGGGCTGCCCGCCCTCCCAGG + Intergenic
1029439677 7:100580082-100580104 ACAGGCCTTCCTGCCATGCCTGG + Intronic
1030044421 7:105482151-105482173 TCTGCTCTCCCAGCCCTGCCAGG + Intronic
1030336122 7:108328603-108328625 TCAGACCTCCCAGGCCTCCCAGG + Intronic
1031976294 7:128095644-128095666 TCTGGCCTCCTCAGCCTGCCTGG + Intergenic
1033562281 7:142544193-142544215 TCATCTCTCCCAGCCCTGCCTGG - Intergenic
1035095973 7:156355902-156355924 TCCAGCCTCCCCGCCCTCACAGG + Intergenic
1035238710 7:157516546-157516568 TCAGGCCTCACACCCCTGCACGG - Intergenic
1035271430 7:157722314-157722336 TCAGGCCTCCCCTCCCTGGCGGG - Intronic
1035345245 7:158193107-158193129 TCCGGCGTCCCTGCCCTGCATGG - Intronic
1035626204 8:1072549-1072571 CCAGGCCGCACCTCCCTGCCAGG - Intergenic
1036435786 8:8732022-8732044 TCTGTCTTCCCCGCCCTGCCTGG + Intergenic
1036663690 8:10725620-10725642 TCAGACCTCCCTGCCCTGAGCGG + Exonic
1039613519 8:38937334-38937356 CCAGGCCTGCCCGCCCTCCCTGG + Intronic
1039755596 8:40518788-40518810 CCAGCCCTCTCCTCCCTGCCAGG + Intergenic
1039954257 8:42195164-42195186 CCAGGCCTTGCCTCCCTGCCTGG + Intronic
1041040090 8:53838047-53838069 CCAGGCCTCAGCTCCCTGCCTGG + Intronic
1041311761 8:56524572-56524594 GCAGACCTCCCTGCCCTGCTGGG + Intergenic
1041430465 8:57776092-57776114 TCCTGCCTCCCTGCCCTCCCAGG - Intergenic
1041713036 8:60910346-60910368 TCAGATGTCCCCGCCCGGCCCGG - Intergenic
1042485014 8:69338829-69338851 TTTGGCCTCCCGGCCCAGCCAGG + Intergenic
1042791217 8:72608305-72608327 TCCTGCCTCCTCTCCCTGCCTGG - Intronic
1044220270 8:89662463-89662485 TGAGGCCTCCCCAGCCTGGCGGG - Intergenic
1044591524 8:93917522-93917544 GCTGCCCGCCCCGCCCTGCCCGG - Intronic
1044806958 8:96018175-96018197 TCAGGACTCATAGCCCTGCCAGG - Intergenic
1046733644 8:117752519-117752541 GCAGGGCTCCCAGCCCTGCTGGG - Intergenic
1049237157 8:141518168-141518190 CCGGCCCTCCCCGCCCTGCCGGG + Intronic
1049376277 8:142290803-142290825 TCCGCCCTCCCGGGCCTGCCAGG + Intronic
1049524553 8:143116446-143116468 TCAGGACTTCCAGACCTGCCTGG - Intergenic
1049556225 8:143283562-143283584 TCTGGCAGCCGCGCCCTGCCTGG + Intergenic
1049607960 8:143538479-143538501 CGAGGCCTCCCGGGCCTGCCTGG + Exonic
1049661282 8:143820803-143820825 CCCGGAGTCCCCGCCCTGCCAGG + Intronic
1049777401 8:144413111-144413133 TCCGGTCTCCCCACCCAGCCAGG + Intronic
1051358768 9:16263646-16263668 TCAGGGCTCTCAGCCCTGGCTGG - Intronic
1051620917 9:19049022-19049044 TTAGGCCTCCCCAGCTTGCCCGG - Intronic
1052991095 9:34519854-34519876 ACAGCCCTCACCCCCCTGCCTGG + Intronic
1053149160 9:35732065-35732087 TCTGGCCTACCTGCGCTGCCTGG + Exonic
1057031855 9:91782092-91782114 TTTGGCCTCCCAGCCCGGCCAGG - Intronic
1057185444 9:93055092-93055114 GCAGGCCTCCCCTGCCTCCCAGG + Intergenic
1058451201 9:105098143-105098165 GCAGGCCTCCCCAACCTGCAGGG + Intergenic
1059451888 9:114376185-114376207 CCAGGCCTCCCCACCCCACCAGG + Intronic
1060214207 9:121728654-121728676 GCAGGCCTCCCCACCCTCACTGG - Intronic
1061005130 9:127924512-127924534 ACAGGCATCCCCACCATGCCTGG - Intronic
1061159990 9:128888196-128888218 TCAGGCCTCCCCTCTCTCCAGGG - Intronic
1061203067 9:129148274-129148296 TCTGCCATCCCCTCCCTGCCAGG - Exonic
1061365702 9:130171820-130171842 GCAGGCCTCCCCGCCTCTCCAGG + Intergenic
1061501937 9:131009104-131009126 TCCAGCCTCCCCGCCCCGCAGGG + Exonic
1061727130 9:132588038-132588060 TCAGGCCTCCCCAGCCTTTCTGG + Intronic
1061843745 9:133375680-133375702 CCGGGCCTCGGCGCCCTGCCTGG - Intronic
1061871409 9:133522622-133522644 CCAGGCCACACCTCCCTGCCTGG - Intronic
1061948195 9:133920509-133920531 TCAGGCCTCCCAGGCCAGCTGGG - Intronic
1062037098 9:134387192-134387214 CCCGGCCGCTCCGCCCTGCCCGG + Intronic
1062088854 9:134663452-134663474 CATGGCCTCCCAGCCCTGCCAGG - Intronic
1062282843 9:135759648-135759670 CCAGGCCGCCCCTCACTGCCAGG + Intronic
1062286918 9:135777527-135777549 TCAGCCCACCCCGCCCACCCGGG + Intronic
1062421332 9:136484000-136484022 CCGGGCCGCCCCTCCCTGCCCGG - Exonic
1062574261 9:137199254-137199276 CCAGGCCTCTGCACCCTGCCAGG - Exonic
1062657587 9:137612289-137612311 TCAGTCCTCTCCGGCCTCCCTGG - Intronic
1203376701 Un_KI270442v1:382773-382795 AGAGGCCTCCCTCCCCTGCCAGG - Intergenic
1185890192 X:3815921-3815943 TCAGGCCTCCAGGCCCACCCCGG - Intergenic
1193641386 X:84013479-84013501 CCAGGCCTCCACCCCCTGACCGG - Intergenic
1195266009 X:103180553-103180575 TCCATCCTCCCCACCCTGCCTGG - Intergenic
1199709720 X:150460580-150460602 TCCTGCCTCCACGCCCTGGCTGG - Intronic
1200092213 X:153641354-153641376 GCTGGCATCCCAGCCCTGCCTGG + Intergenic
1200208219 X:154332883-154332905 CGAGGCCTCCTCGCCCTGCCAGG + Intergenic
1200231232 X:154444782-154444804 TCAGGCCTCCCCGCCTCTCCAGG - Intronic
1201797482 Y:17913869-17913891 ACAGGCCACCGCGCCCGGCCAGG - Intergenic
1201804071 Y:17992090-17992112 ACAGGCCACCGCGCCCGGCCAGG + Intergenic