ID: 1090650154

View in Genome Browser
Species Human (GRCh38)
Location 11:128799315-128799337
Sequence ATTACCAAGCCCATTGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 1, 2: 0, 3: 9, 4: 145}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090650154_1090650157 7 Left 1090650154 11:128799315-128799337 CCTTCCTCAATGGGCTTGGTAAT 0: 1
1: 1
2: 0
3: 9
4: 145
Right 1090650157 11:128799345-128799367 CACCAAGATAAGCATGGTAGAGG 0: 1
1: 0
2: 1
3: 10
4: 114
1090650154_1090650158 8 Left 1090650154 11:128799315-128799337 CCTTCCTCAATGGGCTTGGTAAT 0: 1
1: 1
2: 0
3: 9
4: 145
Right 1090650158 11:128799346-128799368 ACCAAGATAAGCATGGTAGAGGG 0: 1
1: 0
2: 1
3: 9
4: 145
1090650154_1090650160 9 Left 1090650154 11:128799315-128799337 CCTTCCTCAATGGGCTTGGTAAT 0: 1
1: 1
2: 0
3: 9
4: 145
Right 1090650160 11:128799347-128799369 CCAAGATAAGCATGGTAGAGGGG 0: 1
1: 0
2: 3
3: 12
4: 149
1090650154_1090650162 21 Left 1090650154 11:128799315-128799337 CCTTCCTCAATGGGCTTGGTAAT 0: 1
1: 1
2: 0
3: 9
4: 145
Right 1090650162 11:128799359-128799381 TGGTAGAGGGGCAAGCAGGATGG 0: 1
1: 0
2: 2
3: 50
4: 417
1090650154_1090650156 1 Left 1090650154 11:128799315-128799337 CCTTCCTCAATGGGCTTGGTAAT 0: 1
1: 1
2: 0
3: 9
4: 145
Right 1090650156 11:128799339-128799361 TCATCTCACCAAGATAAGCATGG 0: 1
1: 0
2: 1
3: 11
4: 144
1090650154_1090650161 17 Left 1090650154 11:128799315-128799337 CCTTCCTCAATGGGCTTGGTAAT 0: 1
1: 1
2: 0
3: 9
4: 145
Right 1090650161 11:128799355-128799377 AGCATGGTAGAGGGGCAAGCAGG 0: 1
1: 0
2: 3
3: 49
4: 663

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090650154 Original CRISPR ATTACCAAGCCCATTGAGGA AGG (reversed) Intronic
900289527 1:1918003-1918025 ATGGCCAAGCCCAGAGAGGAAGG - Exonic
904578004 1:31517936-31517958 ATTACCATGCCCTTTGATTAAGG + Intergenic
911761094 1:101618510-101618532 TTTACAAAGACAATTGAGGAAGG - Intergenic
916336281 1:163674227-163674249 CCTAGCAAGCCCACTGAGGATGG + Intergenic
917144772 1:171877540-171877562 ATTAGCACCTCCATTGAGGATGG - Intronic
918336870 1:183524491-183524513 ATTTCCATGCCCAGTGAGAAAGG + Intronic
920307154 1:205026397-205026419 ATTAACAGGCCCAGTGGGGAGGG + Intergenic
922616086 1:226961953-226961975 GGCACCAATCCCATTGAGGAGGG + Intronic
1063474590 10:6317308-6317330 ATTACCAAAGTCAATGAGGAAGG - Intergenic
1067824837 10:49563316-49563338 ATAAAGAAGCCCCTTGAGGAGGG - Intergenic
1070322615 10:75365695-75365717 ATTACCAACCCCATTCCAGAGGG - Intergenic
1070399110 10:76037081-76037103 CTTACCAAGCCCTGTGAGAAGGG + Intronic
1071342864 10:84664648-84664670 CTTCCCCAGCCCATTGTGGAGGG - Intergenic
1071686052 10:87758321-87758343 ATTTCCAAACCAATAGAGGAAGG + Intronic
1073995631 10:109312946-109312968 ATTACCAAGCCCTGTGATTAAGG - Intergenic
1074870112 10:117569665-117569687 ATTACCACTCCCATTGTGCAGGG + Intergenic
1079539669 11:21557641-21557663 ATTAGCAACCACATTGAAGAAGG - Intronic
1081306857 11:41523062-41523084 ATTGCCAAGCACTTTGGGGAGGG - Intergenic
1086364652 11:86096349-86096371 AATACCAATCCTACTGAGGAAGG + Intergenic
1086812643 11:91329720-91329742 ATTTCCAAGCCAATTAGGGAGGG - Intergenic
1090288770 11:125523292-125523314 ATTATCATGCCCACTGAAGATGG + Intergenic
1090650154 11:128799315-128799337 ATTACCAAGCCCATTGAGGAAGG - Intronic
1090713491 11:129409435-129409457 GTTACCAAGCCCCTGGAGGGTGG - Intronic
1097739370 12:63221092-63221114 ATTGCCAACCCCATTGAGAAAGG - Intergenic
1098651915 12:72981963-72981985 ATTACCAAGTTCTTTGAGCATGG + Intergenic
1098806106 12:75021724-75021746 ATTACCCAACCCATAGAGGCTGG - Intergenic
1099074238 12:78085018-78085040 ATTACCCATCCCTTTGATGATGG - Intronic
1102563457 12:113779106-113779128 ATTAACAACCCCATGGAGGCAGG + Intergenic
1103615668 12:122150421-122150443 TGTACCAAGCCCATTAAGGCAGG - Intergenic
1110189791 13:72717226-72717248 ATTTCCAAGCAAATTGTGGAAGG - Intronic
1110551611 13:76816804-76816826 ATTGTCAAGCCCACTGAGCAGGG + Intergenic
1114860317 14:26510289-26510311 ATAACCAAGACCACTGAGGGAGG - Intronic
1114892794 14:26946407-26946429 GTTACAAAGACCATGGAGGAAGG + Intergenic
1116158152 14:41234839-41234861 ATTACCATGCCCAGTGATTAAGG - Intergenic
1116211593 14:41953176-41953198 ATGACCAAGCCCATATAGGTAGG - Intergenic
1117356149 14:54925589-54925611 CTTACAAAGCCCAATAAGGAGGG - Intergenic
1119719354 14:76880785-76880807 ATCACCAAAAGCATTGAGGATGG + Intergenic
1120043155 14:79776499-79776521 ATAACCATGCCCATGGGGGAGGG - Intronic
1120185194 14:81386712-81386734 ATTACCATGTCCCTGGAGGAAGG + Intronic
1120594433 14:86416556-86416578 ATGACCAAGACCCTTCAGGAAGG - Intergenic
1125263847 15:37856768-37856790 ATTACCATGGCAATTGAAGAGGG - Intergenic
1125416537 15:39459909-39459931 ATTACTAATCCCATTCATGAGGG + Intergenic
1126777126 15:52110334-52110356 AGCACCAACCCCATTTAGGAAGG + Intronic
1128426765 15:67549590-67549612 ATTACCAGACCCATTTTGGAGGG + Intronic
1128478622 15:68018515-68018537 ATTATCAAGCCCATTGAGGAGGG + Intergenic
1129391814 15:75224498-75224520 ATCACAAAGCCCACTGAGGTGGG - Intergenic
1131064723 15:89426907-89426929 ATTTACATGCCCATTGAAGATGG - Intergenic
1133060572 16:3171861-3171883 CCTACCAAGCCCAGTGTGGATGG + Intergenic
1139110664 16:63886660-63886682 ATCACCAAGCCACCTGAGGAAGG - Intergenic
1148627045 17:49077580-49077602 AATACCAAGCAGATAGAGGAGGG + Intergenic
1152274140 17:79344475-79344497 ATTGAGAAGCCCAATGAGGAAGG - Intronic
1153739048 18:8103826-8103848 ATTATTAAGCACAGTGAGGAAGG - Intronic
1158429914 18:57375928-57375950 ATAACCAAGCCTATTTAGGGAGG + Intergenic
1159191228 18:65045497-65045519 ATGATTAAGCCTATTGAGGAAGG + Intergenic
1161984203 19:7644900-7644922 ATCCCCAAGCCAATGGAGGAGGG - Intronic
1163471256 19:17498436-17498458 AACACCAAGCACACTGAGGAAGG - Intronic
926810148 2:16748895-16748917 ATTACCATGCCCTTTGATTAAGG - Intergenic
927008965 2:18881519-18881541 ATTACCATGCCCTTTGATTAAGG + Intergenic
928087628 2:28355841-28355863 CTCACCCAGCCCACTGAGGATGG + Intergenic
930600639 2:53439039-53439061 AACACCAAGCCCATTGACCACGG + Intergenic
931110888 2:59110368-59110390 ATTTTCAAGCCCATTTGGGAAGG + Intergenic
932470311 2:71950847-71950869 TTTCCCAAGGCCAGTGAGGAAGG - Intergenic
932516766 2:72359283-72359305 ATTACCAATCCCATTCATGATGG - Intronic
933301858 2:80549759-80549781 ATGAACATGCCCATTGAGAAGGG - Intronic
934084250 2:88496768-88496790 ATTTCCAAGCCTATTGATGGTGG - Intergenic
935404843 2:102698238-102698260 AAAACCAAGCACATTCAGGATGG + Intronic
937468822 2:122157921-122157943 ACCAACAAGCCCAATGAGGAAGG - Intergenic
940604577 2:155904322-155904344 ATTACCAATTTCATGGAGGAAGG - Intergenic
941733036 2:168940173-168940195 ATGACTAAGCTCAGTGAGGAAGG + Intronic
943420828 2:187667175-187667197 ATTATCAAGCTTAGTGAGGAAGG + Intergenic
944069757 2:195655939-195655961 ATTTCCAAACCCATTCAGTATGG - Intronic
944571850 2:201053012-201053034 CTCACCAATTCCATTGAGGATGG + Intronic
944625506 2:201564630-201564652 AGTACCAATCCCATTCATGAGGG - Intronic
948029559 2:234805914-234805936 ATGACAAAGCCTATTGAAGAGGG + Intergenic
948162135 2:235833545-235833567 ATTAGCAAGCACTCTGAGGAGGG - Intronic
1168854252 20:997714-997736 ATTGCAAAGCCCCTTGTGGAGGG - Intronic
1169833165 20:9847769-9847791 GTTGCCAAGACCATTCAGGATGG + Intergenic
1173756449 20:45520939-45520961 ATTACCATGCCCTTTGATTAAGG - Intergenic
1174292346 20:49518026-49518048 TTTAGCAATCCCATGGAGGAGGG - Intronic
1177338430 21:19763730-19763752 GTTACTAATCCCATTCAGGAGGG - Intergenic
1182930180 22:34166104-34166126 ATTCTCAAGCTCATGGAGGAGGG + Intergenic
949639150 3:6015336-6015358 ATTACCATGCCCTGTGAGTAAGG + Intergenic
949856884 3:8470011-8470033 ATGACCAAGCCCAAAGAGAAGGG - Intergenic
950155616 3:10719446-10719468 GTTACCAATCCCATTCATGAGGG + Intergenic
950583619 3:13878704-13878726 ATTACCATCCCTTTTGAGGAGGG - Intronic
950679889 3:14577866-14577888 CTTAGCCAGCCCATTGAGGTGGG - Intergenic
954876189 3:53804590-53804612 TTTTCTAAGCCCATTGAGGGTGG + Intronic
957278396 3:78118245-78118267 CTTACCAAGGCCATAGAGGTAGG - Intergenic
957451262 3:80385533-80385555 ATGACCAACCACATTGGGGAAGG + Intergenic
957484179 3:80836012-80836034 ATTACCCAGCACATTAAGGTTGG + Intergenic
961185967 3:124915293-124915315 ATTACCAAGCACAGTGTGGAAGG - Intronic
962294206 3:134166202-134166224 AGTACCAATCCCATTTATGAGGG - Intronic
964009869 3:151879424-151879446 AGTACCAATCCCATTCATGAAGG - Intronic
965176234 3:165336943-165336965 ATTACCAAAACCATGGAGGCAGG + Intergenic
965226516 3:165998962-165998984 ATTACCAAGCCCTATGATTAAGG - Intergenic
967670647 3:192231123-192231145 ATTTCCAAGGCCAGAGAGGATGG - Intronic
970175654 4:13336917-13336939 ATCACAAAGCCCAATGATGATGG + Intergenic
970848894 4:20577937-20577959 ATTACCATTCCAATGGAGGATGG - Intronic
974727511 4:65814663-65814685 ATTACCAAGCCCTGTGATTAAGG + Intergenic
974752980 4:66165548-66165570 ATTACCAATCACCTTGAGGGTGG - Intergenic
975898640 4:79123411-79123433 GTTACCAATTCCATTAAGGAAGG - Intergenic
975900366 4:79144513-79144535 ATTACTAAGCTTAGTGAGGAAGG - Intergenic
977962771 4:103104356-103104378 ATTACCAACCCCAATGAGGTTGG - Intergenic
984183583 4:176514995-176515017 ATTAAAAAGCCCATTGTGAAGGG + Intergenic
984479138 4:180276529-180276551 ATGACGAAGCTCAGTGAGGAAGG + Intergenic
987556308 5:19455591-19455613 ATTACAAAAACCATTTAGGAAGG + Intergenic
989268858 5:39508424-39508446 CTTACCCAGGCCATTGTGGAGGG - Intergenic
989457399 5:41659949-41659971 ATTACCATGCCCTGTGAGTAAGG - Intergenic
990701570 5:58480176-58480198 ATTACAAAGCCCATTCAGGGGGG - Intergenic
991330499 5:65487881-65487903 ATTACCATGCCCAGTGATTAAGG - Intergenic
992154412 5:73940704-73940726 ATGGCCAAGCCCAATGAGAAAGG - Intronic
993598351 5:89888236-89888258 ATTACTAATCCCATTCATGAAGG - Intergenic
994277160 5:97853254-97853276 ATTAGCAAGCCAGTAGAGGAAGG + Intergenic
994656221 5:102596303-102596325 ATTACCAAGCCACTTCAGGAAGG - Intergenic
994856186 5:105122586-105122608 ATCGCCGAGCCCATTGAGGTTGG - Intergenic
994935137 5:106244680-106244702 ATTACCAATACCATGGAGGACGG + Intergenic
995886965 5:116906041-116906063 ATTACTAAGCTTAGTGAGGAAGG + Intergenic
997669282 5:135657058-135657080 ATTCAGATGCCCATTGAGGAGGG - Intergenic
1000654397 5:163858934-163858956 ACTACGAAGCCCTTTGAGGAAGG + Intergenic
1000832405 5:166119413-166119435 TTTACCAAGCTCATTGAGCTTGG - Intergenic
1001322937 5:170697837-170697859 TTTCCCAAGGCCATTGGGGAAGG - Intronic
1003408774 6:5845143-5845165 GTTACCAAGTCCTTTGGGGAAGG - Intergenic
1004298818 6:14438469-14438491 ATTACCAAGCCCTATGATTAAGG + Intergenic
1004402048 6:15297670-15297692 CTTACCAACCCCACTGAGTAGGG - Intronic
1006755814 6:36414361-36414383 ATTACAAATCACATGGAGGAGGG + Intronic
1009525687 6:64742059-64742081 ATGACTAAGCCTATTGAAGAAGG - Intronic
1010591148 6:77713796-77713818 ATCACAAAGCTCATTGTGGAAGG - Intronic
1014363161 6:120506530-120506552 ATTACCAAGCCCTGTGATTAAGG - Intergenic
1017185602 6:151597619-151597641 ATTACCAAGTCCAGTGGAGAAGG + Intronic
1017227562 6:152039281-152039303 ATTACCAAGCCCTGTGATTAAGG - Intronic
1018691716 6:166350737-166350759 ATTATTAAGCATATTGAGGAAGG - Intergenic
1028064958 7:86372230-86372252 ATTACTAAGCTTAGTGAGGAAGG + Intergenic
1028869654 7:95755450-95755472 ATTACAAAGCCAATGGAGAATGG - Intergenic
1030578338 7:111318687-111318709 CTTACCAAGCCACTTGAAGACGG + Intronic
1032448405 7:132004343-132004365 ATGACCAAGCCCAAAGAGGAGGG - Intergenic
1033888920 7:145983756-145983778 GTTACGAATCACATTGAGGATGG - Intergenic
1037221334 8:16526133-16526155 CTTACCAAGGCCGTTTAGGATGG - Intronic
1038151516 8:24945054-24945076 ATTGACAAACCCATTGGGGAAGG + Intergenic
1042711057 8:71718124-71718146 ATTACCAAGTAAATTTAGGAGGG - Intergenic
1044278212 8:90326560-90326582 AGTACCAATCCCATTTATGAGGG - Intergenic
1045608718 8:103809726-103809748 ATTATAAAGCCACTTGAGGATGG - Intronic
1051616375 9:19010779-19010801 ATTACCAGGGGCAGTGAGGAGGG + Intronic
1051967921 9:22851651-22851673 ATTACTAAGCTTAGTGAGGAAGG - Intergenic
1055467975 9:76584103-76584125 ATTTCCAAGCCAAGTGTGGAAGG - Intergenic
1057100355 9:92353447-92353469 ATTACCAAGCCCTGTAAGTAAGG - Intronic
1061895160 9:133643330-133643352 ATTCGGAAGCCCATGGAGGAGGG + Intronic
1186199676 X:7144516-7144538 ATTACCAAGCCCAGTACTGATGG - Intronic
1190427343 X:50345639-50345661 CCTACCAAGTCCATGGAGGAGGG + Intronic
1191239876 X:58177799-58177821 ATTTCTGAGCCCATTGAGAAAGG + Intergenic
1192221284 X:69198941-69198963 CTCACCTAGCCCATTGAGGCAGG + Intergenic
1192362879 X:70450234-70450256 ATCACCAAGATCATTGAGGGGGG + Exonic
1198046288 X:132906605-132906627 AGCACCAAGCCCATTCACGAGGG - Intronic
1200013786 X:153142754-153142776 ATTATTAAGCTCAGTGAGGAGGG + Intergenic
1200025815 X:153257201-153257223 ATTATTAAGCTCAGTGAGGAGGG - Intergenic
1200491883 Y:3835860-3835882 ATTTCCAAGACCAAGGAGGATGG - Intergenic
1200897764 Y:8393956-8393978 ATTAACAAGCCCACTGTTGAAGG - Intergenic