ID: 1090651653

View in Genome Browser
Species Human (GRCh38)
Location 11:128811725-128811747
Sequence CAGAACTTGGAAAAGTTGTA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 345
Summary {0: 1, 1: 0, 2: 0, 3: 36, 4: 308}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090651653 Original CRISPR CAGAACTTGGAAAAGTTGTA GGG Exonic
901700637 1:11043334-11043356 CAGACCTTGAGAAAGTCGTAGGG + Exonic
902182804 1:14702264-14702286 CTGAACTTAGAAAACTTGGATGG + Intronic
902736652 1:18405671-18405693 CAGAACTCAGAAAAGTGGTGGGG - Intergenic
904427225 1:30436648-30436670 CAGAGGTTGGAAGAGTTGGAAGG + Intergenic
906194792 1:43923102-43923124 GAAAAATTGGAAAAGTTGTCTGG + Intronic
906459976 1:46029594-46029616 CACTACTTGGAAAAGGGGTAAGG + Intronic
907622026 1:55991357-55991379 CAGCGCTTGGGAAAGTTGCAAGG - Intergenic
908077686 1:60538944-60538966 CAGAACTCTGAAAACTTCTAGGG + Intergenic
908729093 1:67207855-67207877 CAGAAATTGGAACAGTTTGAAGG + Intronic
908833131 1:68201265-68201287 CAAAACTTAGATAAGTGGTATGG - Intronic
908866412 1:68553771-68553793 CAGAACTTGGAACAGTTTGGAGG + Intergenic
909169609 1:72278763-72278785 CAGAACTTGTTAATCTTGTATGG - Intronic
909308951 1:74121287-74121309 CATGACATGGAAAAGTTGGATGG - Intronic
910491871 1:87781566-87781588 CAGATCTTGGAACAGCTGTTTGG - Intergenic
911780268 1:101868234-101868256 CAGAAGTTGGAACAGTTGGAGGG + Intronic
911855812 1:102873187-102873209 CAGAAGTTGGAACAGTTTGAAGG - Intergenic
912172927 1:107122444-107122466 CAAAATTTGGAAGAGATGTAAGG + Intergenic
914230412 1:145760811-145760833 CAGAAGTTGGAACAGTTTGAAGG + Intronic
915209775 1:154299759-154299781 GAGAATTTTGAAAATTTGTAAGG - Intergenic
916488592 1:165281025-165281047 CAGAACATGGAGAAGTAGTCTGG + Intronic
917291838 1:173478244-173478266 CAGAACTTGCAACACTTGGAGGG + Intronic
917787173 1:178471177-178471199 CAGAACTGGGATAAATTATAAGG - Intronic
917828717 1:178853593-178853615 CAGAAATTGGGAAAATTATAAGG - Exonic
919169470 1:193935771-193935793 CAAAACTTGGAAAAACTGTTTGG + Intergenic
920139453 1:203797282-203797304 CAGAACTTAGAAAATTGGAAGGG + Exonic
920300216 1:204983863-204983885 CAGTACTTGAAAAAGTGGTGGGG - Intronic
921063552 1:211606870-211606892 CATCACTTGGAGATGTTGTAAGG - Intergenic
1062784356 10:250070-250092 AAGAACATGGAAAAGTTATTCGG - Intronic
1064647914 10:17479013-17479035 CAGAGCGTGGAAAAGTGGTCAGG - Intergenic
1065323652 10:24531850-24531872 CAGGACTTGGAAAAGCTGGGGGG + Exonic
1066754939 10:38701752-38701774 CAGAAGTTGGAAAAGTTTGAAGG - Intergenic
1068563575 10:58545723-58545745 CAGTACTTGGAAGAGTGGAAGGG + Intronic
1069189196 10:65466324-65466346 CAGAGGTTGGAACAGTTGGAGGG + Intergenic
1071327631 10:84533114-84533136 CAGAACTTGGAACAGTTTGGAGG + Intergenic
1072512744 10:96144595-96144617 AAGAACTTGCAAAGGTTGTAAGG + Intronic
1073820064 10:107251669-107251691 CAGAACAGGGTAATGTTGTAAGG - Intergenic
1075243871 10:120802785-120802807 CAGAACATGGACAAGTTTCATGG + Intergenic
1077622756 11:3742180-3742202 CAGAATTTGGAACAGTTCTATGG + Intronic
1077836345 11:5930737-5930759 CCGCACTTGAAACAGTTGTAAGG - Intronic
1079559529 11:21804651-21804673 CAGAGATTGGAACAGTTGAAGGG - Intergenic
1081181525 11:39990976-39990998 CAGAAATTGGAAGAGTTTGAAGG + Intergenic
1083136212 11:60679020-60679042 CAGAAGTTGGAAGAGTTTGAAGG - Intergenic
1084618382 11:70251703-70251725 CCCAACATGGTAAAGTTGTAGGG - Intergenic
1085555757 11:77420107-77420129 CAGAACTAGGAAAAGGTTCATGG + Intronic
1085676532 11:78525155-78525177 CAGAGCATAGAAAAGTTCTAGGG + Intronic
1085690085 11:78657354-78657376 CAGGATTTGCAAAAGTGGTAGGG + Exonic
1086185053 11:84003292-84003314 CAGAGGTTGGAAAAGTTTTGAGG - Intronic
1086564808 11:88213091-88213113 CAGAAGTTGGAAGAGTTTGAAGG - Intergenic
1086668602 11:89518285-89518307 CAAAATTTGGAAAAGGTTTATGG + Intergenic
1090651653 11:128811725-128811747 CAGAACTTGGAAAAGTTGTAGGG + Exonic
1093712949 12:22348400-22348422 CAGAACATGCAACAGGTGTATGG - Intronic
1095039612 12:37426715-37426737 CAGAAGTTGGAACAGTTTCAAGG + Intergenic
1095544236 12:43345850-43345872 CAGAAGTTGGAACAGTTTGAAGG - Intergenic
1097064217 12:56308888-56308910 CAGAACTTCATAAAGTTCTATGG + Intronic
1098776374 12:74624723-74624745 CAGAACATAGAAAACTTTTAGGG + Intergenic
1099004004 12:77215815-77215837 CAGAGGTTGGAACAGTTGGAGGG + Intergenic
1099152948 12:79138107-79138129 CAGTACTTGAGAAAGCTGTATGG - Intronic
1099249329 12:80233814-80233836 CAGAACTTATAAAAGTTGAAAGG - Intronic
1099778733 12:87166810-87166832 CAGAAGTTGGAACAGTTGGAGGG - Intergenic
1100546888 12:95611918-95611940 AAGACCTTAGAAAAGTGGTAGGG + Intergenic
1101148314 12:101862660-101862682 TACAACTTAGAAAAGTAGTATGG + Intergenic
1101424468 12:104576533-104576555 CAGAACTTGGAAAAGAGCAACGG + Intronic
1102806903 12:115789972-115789994 CAGAGATTGGAAAGGTTGTGGGG - Intergenic
1103505090 12:121437390-121437412 CAAAAATTGGAAAAGATGGAGGG + Intronic
1103551050 12:121737712-121737734 CAGAACTTGCACAAGTTGCCAGG + Intronic
1104430929 12:128715402-128715424 CAGTGCTAGGACAAGTTGTAAGG + Intergenic
1105202027 13:18189496-18189518 AAAAAATTGGAAAAGTTGTTGGG - Intergenic
1105387008 13:19940122-19940144 CTGAAATTGGAAAAGTTATGAGG + Intergenic
1109431057 13:62235924-62235946 CAGAAGTAGGAACATTTGTAAGG + Intergenic
1110437814 13:75494982-75495004 CAGAACTTGAGAAAGTTTCATGG + Intergenic
1110865860 13:80395376-80395398 CAGAACCTGCAAATGTTATACGG + Intergenic
1110901931 13:80835071-80835093 CAGAAGTTGGAAGAGTTGGAGGG - Intergenic
1111013871 13:82350243-82350265 CAGAAAATGGAAAAGTTGCATGG - Intergenic
1111292336 13:86185960-86185982 CTGAACTGGGGAAAGATGTAAGG + Intergenic
1111323794 13:86664756-86664778 CAGAGTTTGGAACAGTTGGAAGG - Intergenic
1111510335 13:89253498-89253520 CAGCACTTGGAGAAATTCTATGG - Intergenic
1112580168 13:100671667-100671689 CAGAACTGGGAAATGATGTAGGG - Intronic
1113009761 13:105750413-105750435 CAAAACTGGGAAAAGCTTTATGG - Intergenic
1113040021 13:106094737-106094759 CACAACTTGGAAAAGTTCACAGG + Intergenic
1114145665 14:19974349-19974371 TAGAACTTATAAAAGTTTTATGG - Intergenic
1114161888 14:20177641-20177663 CAGAACTTAGAAAATATGTGGGG + Intergenic
1114780761 14:25536083-25536105 CAGAACATGGAAAACTATTAAGG + Intergenic
1114793645 14:25686998-25687020 TAGAACTTTGAAAAGATGAAAGG + Intergenic
1114991019 14:28289931-28289953 CAGATGCTGGAAAGGTTGTAGGG - Intergenic
1118120085 14:62830266-62830288 CAGAGGTTGGAATAGTTGGAGGG - Intronic
1118852050 14:69591674-69591696 CAGAGCTTGGAAAAGATATCTGG - Intergenic
1118920129 14:70142431-70142453 CACAAATTTGCAAAGTTGTATGG - Intronic
1120345660 14:83286580-83286602 TAGAAACTGGAAAATTTGTATGG + Intergenic
1120405141 14:84084792-84084814 CAGAAGTTGGAACAGTTTGAAGG - Intergenic
1121658661 14:95618055-95618077 CAGTTCTGGGAAAAGATGTAAGG + Intergenic
1122766583 14:104075997-104076019 AAGAATTTGGAAAAGGTGGAAGG + Intergenic
1124563716 15:30797071-30797093 AAGAACTCAGAAAAGTTGGAAGG - Intergenic
1124802450 15:32847251-32847273 CATAACGTTGAAAAGATGTAGGG + Intronic
1125933548 15:43616463-43616485 GAGAAGTTGGAAATGCTGTAGGG + Exonic
1125946646 15:43715925-43715947 GAGAAGTTGGAAATGCTGTAGGG + Intergenic
1126104798 15:45140574-45140596 CAGAATGTGCAAAAGTTGAATGG - Intronic
1126986175 15:54312359-54312381 CAGAAAGTGGAAAATTTTTAGGG - Intronic
1127965130 15:63917665-63917687 AGGAACTTGGAACAGTTGAATGG - Intronic
1128597091 15:68962808-68962830 CTGAACAGGGAAAAGTTGAAAGG - Intronic
1128852959 15:70980320-70980342 AATAACTTGTAAAAGTTTTAGGG - Intronic
1129149242 15:73677312-73677334 AAGAACTTGGAAAAGGAGTAGGG + Intergenic
1136727747 16:32375086-32375108 CAGAAGTTGGAAAAGTTTGAAGG + Intergenic
1137590358 16:49689724-49689746 CTGACCTTGGTAAAGTTGTGTGG - Intronic
1140594930 16:76397282-76397304 GAGAACTGAGAAAAGTTGTGGGG + Intronic
1202998688 16_KI270728v1_random:142668-142690 CAGAAGTTGGAAAAGTTTGAAGG - Intergenic
1203130285 16_KI270728v1_random:1679072-1679094 CAGAAGTTGGAAAAGTTTGAAGG - Intergenic
1144023036 17:11253888-11253910 CAGACTTTGGAAAACTTGTCCGG + Intronic
1145357934 17:22180660-22180682 CAGAACATGAGAAAGTTGTGTGG + Intergenic
1145876964 17:28326295-28326317 CATAACTCGGAAAAGCTCTAGGG - Intronic
1146678309 17:34789120-34789142 CAGAAATTAGACAAGTTATAGGG + Intergenic
1148404843 17:47402153-47402175 AAGAATTTGCAAAAGTAGTAAGG + Exonic
1148612352 17:48972735-48972757 GAGGACTTGGCAAAGTTGTTGGG - Intergenic
1149959941 17:61097521-61097543 GAGAAATTGGAAAAGTAGCAGGG + Intronic
1151077913 17:71295649-71295671 CAGAGAATGGAAAAGTTATATGG - Intergenic
1151120985 17:71792775-71792797 AAACACTTGGAAAAGTTGCATGG - Intergenic
1153845978 18:9050261-9050283 CAGAAGTTGGAACAGTTTGAAGG + Intergenic
1154006444 18:10532529-10532551 CAATAATTGGAAAAGTTGTAAGG + Intronic
1154462799 18:14611985-14612007 TAGAACTTAGAAAAGTTTTATGG - Intergenic
1155482653 18:26305971-26305993 TAGAATTTGGTAAGGTTGTAGGG + Intronic
1156769076 18:40697770-40697792 CAGCACTTGGAACAGTTGGGAGG + Intergenic
1157082535 18:44541759-44541781 AAGAACCTGGAAAAATAGTAAGG + Intergenic
1157104631 18:44762172-44762194 CAGAACTGGGAAAAGAAGTCAGG - Intronic
1157173392 18:45428623-45428645 CTGTACTTGGAAAAGTAGAAAGG + Intronic
1157189914 18:45572427-45572449 GATAACTTGGAAAAGATGTTGGG - Intronic
1159822154 18:73159092-73159114 TAGAAATTGGAAAAATTGTCAGG + Exonic
1160000193 18:75011039-75011061 CAGCACTTGGAAAACCTGTGTGG + Intronic
1160601760 18:80019076-80019098 CAGAGATTGGAAAAGTTTGAAGG - Intronic
925244370 2:2367277-2367299 CAGATCTTAGAAAAGTTATAGGG + Intergenic
925655098 2:6138356-6138378 CAGAACTTTGGAAGGTTGGAAGG + Intergenic
926630097 2:15128346-15128368 CAGATCTTGGAAAGGTATTATGG - Intergenic
926661425 2:15471388-15471410 TATAACATGAAAAAGTTGTATGG - Intronic
928478396 2:31654957-31654979 CAGAACTTGGAGAAGAAGAAAGG - Intergenic
928668906 2:33580231-33580253 CAGAAATTGGAAAGATTGCAGGG - Intergenic
929167733 2:38900641-38900663 CAGAATCTGGAAAGGTTGTCTGG - Intronic
929938488 2:46312509-46312531 TAGAACTTTGAAAAGTTTAAAGG + Intronic
930014428 2:46960576-46960598 CATCACCTGGGAAAGTTGTAAGG - Intronic
931086135 2:58832553-58832575 CAGAACTTGAGAAAAGTGTATGG + Intergenic
931905212 2:66835266-66835288 CAGAACTTTTAAAAGTTGATTGG + Intergenic
934318224 2:91945987-91946009 CAGAAGATGGAAAAGTTTGAAGG - Intergenic
934669365 2:96200070-96200092 CAGGACTGCGAAAAGTTGTGTGG + Intronic
935320616 2:101884788-101884810 CAGGACTAGGGAAAGTTGTAAGG + Intronic
935535420 2:104287342-104287364 GAGAACTTGGAAAACTTATTAGG + Intergenic
935547914 2:104420023-104420045 CAGAATCTGGAAAAGTTGATTGG - Intergenic
936456275 2:112676928-112676950 CACAACTTTTAAAAGTTTTAAGG - Intergenic
936788095 2:116119401-116119423 CAGAGGTTGGAAAAGTTGGGAGG + Intergenic
936817254 2:116474286-116474308 GAGACCCTGGAAAAGTTTTAAGG - Intergenic
939126828 2:138187556-138187578 CAGAACTTGCAAAAGTGCCAAGG - Intergenic
939194517 2:138955617-138955639 TAGAAGCTGGAAAAGTTTTAGGG - Intergenic
939241852 2:139571815-139571837 CAGAAGTTGGAAGAGTTTGATGG + Intergenic
939452970 2:142397768-142397790 CAGAAGTTGGAACAGTTTGAAGG + Intergenic
943391939 2:187280927-187280949 CAGAGCTGGGAAAAGTAGTAGGG - Intergenic
943553496 2:189371386-189371408 CAGAAGTTGGAAGAGTTTTGAGG + Intergenic
943556539 2:189412954-189412976 AAGAGAATGGAAAAGTTGTATGG + Intergenic
943617107 2:190105580-190105602 CAGAGATTTGAAAGGTTGTAAGG - Intronic
945143450 2:206712446-206712468 AAGATCTTGAAAAAGTTGTCTGG - Intronic
945697508 2:213126269-213126291 AAGAAATGGGAAAAGTGGTAGGG - Intronic
945774926 2:214094649-214094671 CAGAACTTACACAATTTGTATGG + Intronic
947220386 2:227786156-227786178 GAAGACTTGGAAAAGTTATAGGG + Intergenic
947295593 2:228627177-228627199 CAAAATGTGGAAAAGTTGTTGGG + Intergenic
948009023 2:234635986-234636008 CAGAAGTTGGAACAGTTTTGAGG + Intergenic
1169033286 20:2429971-2429993 GGGCATTTGGAAAAGTTGTAGGG + Intronic
1169322162 20:4641901-4641923 CAGCCCCTGGAAAAGTTGGAAGG - Intergenic
1169444196 20:5657756-5657778 AAGAACTTGGAAAGGTTACAAGG + Intergenic
1170237590 20:14124499-14124521 CAGAACTTGGTACAATTGTTAGG + Intronic
1170814262 20:19699344-19699366 CAGAACTTAGAAGAGTTATTTGG - Intronic
1170926308 20:20727534-20727556 CAACACTCAGAAAAGTTGTATGG + Intergenic
1171034226 20:21703395-21703417 CCGAGCTTGGAAAAGTGGCAAGG - Intergenic
1173735087 20:45354961-45354983 CAGACCTTGGACAAGGTGCAAGG - Intergenic
1174934377 20:54851805-54851827 CAGAATTGGGTAAAGTTGTAGGG - Intergenic
1175006769 20:55691711-55691733 CAAAACTTGGAAAAAGTGTTTGG - Intergenic
1175535023 20:59704309-59704331 CAGAAGTTTGAAAAATTGTTAGG + Intronic
1176715923 21:10348511-10348533 AAAAAATTGGAAAAGTTGTTGGG + Intergenic
1176811730 21:13546395-13546417 TAGAACTTAGAAAAGTTTTATGG + Intergenic
1178612353 21:34095455-34095477 CAGAAGTTGTAAAAGCAGTAAGG - Exonic
1178868177 21:36347994-36348016 CAGAATTAGGATTAGTTGTATGG + Intronic
1179966036 21:44806402-44806424 CAGTATATGGAAAAGTTGAAGGG - Exonic
1180306402 22:11129668-11129690 CAGAAGTTGGAAAAGTTTGAAGG - Intergenic
1180544921 22:16491851-16491873 CAGAAGTTGGAAAAGTTTGAAGG - Intergenic
1182965388 22:34516703-34516725 CAGAACTTGGAGAACTTGGATGG - Intergenic
1184933076 22:47695971-47695993 CATAACTTGGGAAAGTTGCTTGG - Intergenic
951830566 3:26921778-26921800 CAGAGCTCGGAGAAGTTGAAAGG + Intergenic
953658944 3:44876350-44876372 CACAACTTGCTAATGTTGTAAGG - Intronic
954192259 3:48972013-48972035 CAGAACGTGCAAAATCTGTAGGG - Intronic
956572643 3:70713501-70713523 CAGAGGTTGGAACAGTTGCAGGG - Intergenic
957044335 3:75362324-75362346 CAGTCATTGGAAAAGTTGTTAGG - Intergenic
958732490 3:97973828-97973850 CACCACTTGGAAAAGCAGTACGG + Intergenic
959385560 3:105701427-105701449 CACAACTTGTAAAAATTGGATGG + Intronic
959803497 3:110524152-110524174 CAGAAGTTGGAACAGTTGGGAGG + Intergenic
959815558 3:110670031-110670053 CAGAAGTTGGAACAGTTTGAAGG + Intergenic
960381778 3:116971383-116971405 GAGAACTTTGAAAAGTAGGAAGG + Intronic
960676899 3:120203997-120204019 CAGTACTTGGAAGAGATGAAAGG + Intronic
962124467 3:132601160-132601182 CAGAACTTGACAATGTTATAAGG - Exonic
962503045 3:136014919-136014941 CTGAACAAGGAAAAGTTGAAAGG - Intronic
962515427 3:136145585-136145607 TGGAACTTGAAAAAGTAGTAAGG + Exonic
962957164 3:140276733-140276755 CAGTCCTTGGAAAACTAGTATGG + Intronic
963706678 3:148697572-148697594 CTGAACTTGGAAAACTTTTAAGG - Intergenic
964101184 3:152990224-152990246 CAGAATTTGGAAAATTTCTGGGG + Intergenic
964724637 3:159801738-159801760 CAGAATTTTAAAAAATTGTAAGG - Intronic
965134182 3:164740457-164740479 CAGAAGTTGGAAGAGTTTTGGGG - Intergenic
965349297 3:167594189-167594211 CAAAAGTTGGAAAAGTTTGAAGG + Intronic
965678115 3:171221071-171221093 TAGAACTTGGAAAGCTTCTAGGG - Intronic
967409375 3:189152013-189152035 CAGAACCTGGAATAGGAGTATGG + Intronic
967425299 3:189319888-189319910 CAGCACCTGCAAAAGCTGTAAGG - Intronic
968375247 4:34878-34900 CAGAAGTTGGCAAGGTTGCAGGG - Intergenic
969033688 4:4233281-4233303 CAAAACTTGGAAAAAATGAATGG + Intergenic
969941074 4:10732460-10732482 CTGAACTTGGAAAAGTCCTGTGG + Intergenic
970706839 4:18815022-18815044 CAGAGGTTGGAAAATTTGGACGG + Intergenic
971049802 4:22848899-22848921 GAAAACTGGGAAAAGTTCTAAGG - Intergenic
971473560 4:27051683-27051705 CAGAATTTGCAAAAGTTGAATGG + Intergenic
971682016 4:29712186-29712208 CAGAAGCTGGAAAGGTTGTGTGG - Intergenic
972112979 4:35589109-35589131 TAGAACTTGGTAAAGCTGAATGG - Intergenic
972199869 4:36702019-36702041 CAGAAGTTGGAACAGTTTGAAGG + Intergenic
973212925 4:47636909-47636931 CAGAATTTGGAAAAGTTTGGAGG + Intronic
973839419 4:54845591-54845613 CAGATGGTGGAAAAGTTGTGAGG + Intergenic
975933098 4:79550844-79550866 CTGAACAGGGAAAAGTTGAAAGG + Intergenic
977392304 4:96427182-96427204 TAGAACTATGAAAAGTTGTAGGG - Intergenic
977950711 4:102967273-102967295 CAGAAGTTGGACAAGTTTGAAGG - Intronic
978666100 4:111183673-111183695 CAGAAGTTGGAACAGTTTGAAGG - Intergenic
978846184 4:113275679-113275701 CTGAACTCTGAAAAGTTGGAAGG + Intronic
978983572 4:114982208-114982230 CAGAAGTTGGAACAGTTTGAAGG + Intronic
979542091 4:121896214-121896236 CTGAACTGGGAAAAGCTGAAAGG + Intronic
979855645 4:125630273-125630295 CAGAACTGTCAAAAGTTGTTTGG - Intergenic
980383450 4:132057523-132057545 CAGAAGTTGGAATAGTTTTGAGG + Intergenic
980616861 4:135239443-135239465 CAGAAGTTAGAAAAGTTACAAGG - Intergenic
981132916 4:141178105-141178127 AAGCACTTAGGAAAGTTGTAGGG + Intronic
981393545 4:144219679-144219701 TAGACCATGGAAAAGTTTTAGGG + Intergenic
981723311 4:147823139-147823161 CAGAACTTGGAGAAGCTGCTGGG + Intronic
983508178 4:168578000-168578022 AAGAACATTGAAAAGTAGTATGG - Intronic
984839582 4:184055814-184055836 CAGAACTCAGAAAAGAGGTAAGG - Intergenic
984992228 4:185392218-185392240 AAGAACTTGGAGAACTTGAAAGG - Intronic
986435655 5:7727676-7727698 CAGAACTTGGACAAAATGGATGG - Intronic
987482716 5:18478568-18478590 CAGAACTTGGATAAGATGTGAGG + Intergenic
988070156 5:26277521-26277543 AAGAAGTTGGAACAGTTGGAAGG + Intergenic
989234661 5:39132496-39132518 AGGAAGTTGGAAGAGTTGTAGGG - Intronic
989817329 5:45751841-45751863 CAGAAGTTGGAATGGTTGGAGGG - Intergenic
990287848 5:54317841-54317863 TAGAACTTGGTAAACTTGTCTGG - Intergenic
991985864 5:72286296-72286318 AAGAACATGCAAAAGTTGAAGGG + Intronic
993036867 5:82768602-82768624 CAGAAGTTGGAACAGTTTGAAGG + Intergenic
993812599 5:92500908-92500930 CAGGACTTTAAAAAGCTGTAAGG - Intergenic
994702528 5:103154433-103154455 AAAAACTTTGAAAAGTAGTATGG + Intronic
994881121 5:105498059-105498081 GAGCACCGGGAAAAGTTGTAAGG - Intergenic
995120758 5:108533248-108533270 CAGAGGTTGGAACAGTTGGAGGG - Intergenic
996417808 5:123228978-123229000 CAGGACTTTGAAGAGTTTTATGG - Intergenic
996495441 5:124149592-124149614 CTGAACAGGGAAAAGTTGAAAGG + Intergenic
996580356 5:125025516-125025538 CAGAGCTTGGAAAAGTGATCTGG + Intergenic
996987686 5:129586562-129586584 CAAAACTTGGAAAAGGTGAATGG - Intronic
997181515 5:131833465-131833487 CAGAAGTTGGAACAGTTTTGAGG - Intronic
997906239 5:137820208-137820230 TATAATTTGGAAAAGTTTTAAGG - Intergenic
998889245 5:146729008-146729030 CAGAGATTGGAAAAGTTTGAAGG + Intronic
999668233 5:153935263-153935285 CAGAAATTGGAACAGTTTGAAGG - Intergenic
1000083681 5:157870304-157870326 CAGCACTTGGGAAGGTTGGAAGG + Intergenic
1000564691 5:162833332-162833354 AAGAACTAGGAAAAGGTGTTTGG - Intergenic
1001853953 5:174994725-174994747 CAGAACTTGGAATATGTGTTTGG + Intergenic
1001885346 5:175285204-175285226 CAGAGTTTTGAAAAATTGTATGG - Intergenic
1002088177 5:176788892-176788914 CAGAATCTGGAAAAGTTGGTGGG - Intergenic
1002977772 6:2101249-2101271 TAGAACTTGGGAAAGTTCTTAGG + Intronic
1003210385 6:4058960-4058982 CAGACCATGGAAAAGATGGAGGG + Intronic
1003419635 6:5945442-5945464 CAAAACTTGGGACAGTTGTCAGG + Intergenic
1003976994 6:11353878-11353900 AACAACTTGTAAAAGTTGAAAGG + Intronic
1004328224 6:14696750-14696772 CAGAACATGGTAAGGTTGGAAGG + Intergenic
1006865120 6:37203237-37203259 CAGAAGTTGGAGAAGGTGGATGG + Intergenic
1007067485 6:39006521-39006543 CAAAAGTTTAAAAAGTTGTAAGG - Intronic
1007543087 6:42668060-42668082 GAGCACTTAGAAAAGTTGTTAGG - Intronic
1008294747 6:49761784-49761806 CAGAAGTTGGAAGAGTTAGAAGG - Intergenic
1008795315 6:55295502-55295524 AAGTACTTGGAAAAGTTTAAAGG + Intergenic
1010360013 6:74982266-74982288 AGTAACTTGGAAAAGTTGGATGG - Intergenic
1012011897 6:93799038-93799060 AAGAACTTGGATAATTTGTCAGG - Intergenic
1012068314 6:94578104-94578126 CAGAGGTTGGAACAGTTGGAGGG - Intergenic
1012700344 6:102449708-102449730 CAGAACTTGACAAAGTGGTAGGG + Intergenic
1013172428 6:107648745-107648767 CAGAAATAGGAAAAGGTGGATGG - Intronic
1013214672 6:108016393-108016415 CAGAAATTGGAACAGTTTGAAGG - Intergenic
1013796557 6:113895421-113895443 CAGATCTTGGAGAAGTTGTGGGG + Intergenic
1015526042 6:134175866-134175888 CAGAACTTGGAAGAGGAGGAAGG + Intronic
1015734248 6:136380860-136380882 CACATCTTGGAAAAGTGATATGG + Intronic
1015979376 6:138823509-138823531 CAGAACTTGACAATGTTATAAGG - Intronic
1016595350 6:145791741-145791763 CAGAAGTTGGAAAAGTTTGGAGG - Intergenic
1017516743 6:155162989-155163011 GAGAACTTGGAAAAGGTCTGGGG + Intronic
1018051387 6:160011890-160011912 AAGAACTTTCAAAGGTTGTAAGG + Intronic
1018832797 6:167457908-167457930 AAGAACTTGGAGAAGTTTTATGG + Intergenic
1019050860 6:169182505-169182527 CAGAAGTTGGAACAGTTGGGAGG - Intergenic
1020671664 7:11122858-11122880 CAGAACTTGGAAAAGACAAAGGG - Intronic
1020826447 7:13035235-13035257 CAGAAGTTGGAAGAGTTGGGAGG + Intergenic
1021792949 7:24224755-24224777 CAGAACTTTGAAAATTAATAAGG + Intergenic
1022149642 7:27588250-27588272 GTGAACTTGGAAAATGTGTAAGG + Intronic
1022909403 7:34885593-34885615 TAGAACTTGTAAATGTTGTAAGG + Intergenic
1023548999 7:41348777-41348799 CAGAAGTTAGAAAAGGTGAAAGG - Intergenic
1024593192 7:50907876-50907898 CAGAAGCTGGCAAGGTTGTAGGG + Intergenic
1026367006 7:69658522-69658544 CAGAACCTAGAAAAGTAATAAGG - Intronic
1027244286 7:76356271-76356293 CAATACTTGAAAAAGTTGTGCGG - Intronic
1027527587 7:79289794-79289816 TAAAACTTGGAAATGTTTTAAGG - Intronic
1027743487 7:82042387-82042409 CAGAACTTTGAAATGGTATATGG + Intronic
1028342216 7:89735509-89735531 CAGACCTTGGAGACGTTGTCAGG - Intergenic
1031159311 7:118146814-118146836 TAGAATTTGGAAAAGTGCTATGG + Intergenic
1031918063 7:127581727-127581749 CAGAAGTTGGAACAGTGGTAAGG - Exonic
1032473420 7:132194570-132194592 CAGAACTTGGAACAGACCTAAGG + Intronic
1033727367 7:144133031-144133053 GAGAACTTCGATAAGTTATAAGG - Intergenic
1037940053 8:22944450-22944472 CAGCTCTTGGAGATGTTGTAAGG - Intronic
1038084898 8:24185195-24185217 CAGAACATGGAGAACTTTTAGGG + Intergenic
1039568614 8:38568462-38568484 CTGAACTTGGAATAGCTGTGTGG + Intergenic
1040621665 8:49098795-49098817 AAGAACTTAGAAAATTTCTAGGG + Intergenic
1041222853 8:55669409-55669431 CAGAGGTTGGAAAAGTTTGAAGG + Intergenic
1041957717 8:63574592-63574614 CAGAATTTGGAATAAATGTATGG - Intergenic
1043285879 8:78530438-78530460 CTGAACTAGGAAAATCTGTAAGG + Intronic
1045437116 8:102174479-102174501 CAGAAGTTGGAAGAGTTGGGAGG - Intergenic
1045880240 8:107029837-107029859 CAGAGGTTGGAAGAGTTGTGAGG + Intergenic
1046134586 8:110010277-110010299 CAGAAGTTGGAAAAGTTCGGAGG + Intergenic
1048526155 8:135204938-135204960 CAGAGGTTGGAAGAGTTGGAAGG + Intergenic
1048788376 8:138076538-138076560 CAGAACTAGGATAAGGTGAAAGG - Intergenic
1048920652 8:139227016-139227038 CTGAATTTGGAAAATTTGGAAGG + Intergenic
1050962661 9:11756005-11756027 CAGAACTAGGAAAACTCTTATGG - Intergenic
1051975533 9:22943040-22943062 CAGAGCTTGGAACAGTTTGAAGG - Intergenic
1052637374 9:31122259-31122281 CAGAGATTGGAAAAGTTTGAAGG - Intergenic
1052660762 9:31427298-31427320 CAGAATTTGTAAAAATTGCAAGG - Intergenic
1054707771 9:68480134-68480156 CAGAGCTTTGAAAAGTTATTTGG + Intronic
1055340623 9:75278532-75278554 CATAAATTTGAAAAATTGTAAGG - Intergenic
1056603093 9:88061736-88061758 CAGAATGTGGAAAGGTTGCAGGG - Intergenic
1058007128 9:99928999-99929021 CAAAACTTTGAAAATATGTATGG - Intronic
1058712719 9:107694900-107694922 CATAACTTGGAAATTCTGTAGGG + Intergenic
1059674817 9:116528089-116528111 CAGAAGTTGGAACAGTTTTGAGG + Intronic
1059753716 9:117272905-117272927 CAGAGATTGGAACAGTTGGAGGG - Intronic
1062226384 9:135454711-135454733 CAGAAAATGGAAAAGTGGCAAGG - Intergenic
1062260168 9:135658179-135658201 CTTAACTTGGGACAGTTGTAAGG - Intergenic
1203573977 Un_KI270744v1:159272-159294 CAGAAGTTGGCAAGGTTGCAGGG + Intergenic
1186086928 X:6000794-6000816 CAGAAATTGGAACAGTTTGAAGG - Intronic
1186372974 X:8966046-8966068 CAGAGGTTGGAAAAGTTTTCAGG - Intergenic
1188948087 X:36333393-36333415 CACAACTTAGAAAGGCTGTAGGG - Intronic
1189606411 X:42682766-42682788 GTGAACTTGGAAAAGCTCTAAGG - Intergenic
1189722164 X:43931232-43931254 GATAACTTGGAAAACTTGTCAGG - Intergenic
1190394885 X:49971716-49971738 CAGAGCTGGGGAAAGTGGTAAGG + Intronic
1190793895 X:53723830-53723852 CAGAAGTTGGAAAAATTTGAAGG + Intergenic
1191122566 X:56921407-56921429 CAGAATTTGGAAAAATTTGAAGG + Intergenic
1191211551 X:57890215-57890237 CAGAAGTTGGAACAGTTTTTAGG - Intergenic
1192111019 X:68364444-68364466 TAGAAATTGGAAAAGTTGTTGGG - Intronic
1192501446 X:71656227-71656249 CAGAGATTGGAACAGTTTTAAGG - Intergenic
1194083781 X:89500726-89500748 CAGAAGTTGGAAGAGTTATGAGG - Intergenic
1196888379 X:120268961-120268983 AAGAATTTGTAAAAGTTGTAAGG + Intronic
1197556094 X:127956565-127956587 CCAAATTTAGAAAAGTTGTAGGG - Intergenic
1198834283 X:140784916-140784938 CATTACTTTTAAAAGTTGTAGGG - Intergenic
1199480830 X:148296915-148296937 CAGAACTTGGAACAGTTTGGAGG + Intergenic
1199537340 X:148917637-148917659 CAGTAGTTGGAGAAGTTGGATGG + Intronic
1199995689 X:153024352-153024374 AAGAACTTGGTATAGTGGTATGG - Intergenic
1200436430 Y:3156608-3156630 CAGAAGTTGGAAGAGTTATGAGG - Intergenic
1200849812 Y:7871409-7871431 AAGAACTGGGCAAAGGTGTATGG + Intergenic
1201185779 Y:11401068-11401090 CAGAAGTTGGAAAAGTTTGATGG - Intergenic
1201351656 Y:13050123-13050145 CTGAAGCTGGAAAATTTGTAAGG - Intergenic