ID: 1090655165

View in Genome Browser
Species Human (GRCh38)
Location 11:128837672-128837694
Sequence AAGAACAGTGGGAAGTCTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 325
Summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 291}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090655165_1090655169 -3 Left 1090655165 11:128837672-128837694 CCATCAGACTTCCCACTGTTCTT 0: 1
1: 0
2: 3
3: 30
4: 291
Right 1090655169 11:128837692-128837714 CTTAGTCAGAAGGACCAGAGTGG 0: 1
1: 0
2: 0
3: 13
4: 137
1090655165_1090655172 26 Left 1090655165 11:128837672-128837694 CCATCAGACTTCCCACTGTTCTT 0: 1
1: 0
2: 3
3: 30
4: 291
Right 1090655172 11:128837721-128837743 GATCTGTACAAATACAGCCCAGG 0: 1
1: 0
2: 0
3: 8
4: 105
1090655165_1090655170 4 Left 1090655165 11:128837672-128837694 CCATCAGACTTCCCACTGTTCTT 0: 1
1: 0
2: 3
3: 30
4: 291
Right 1090655170 11:128837699-128837721 AGAAGGACCAGAGTGGTGCATGG 0: 1
1: 0
2: 2
3: 29
4: 301

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090655165 Original CRISPR AAGAACAGTGGGAAGTCTGA TGG (reversed) Intronic
900542265 1:3209050-3209072 GAGAGCAGTGGGAATTCAGAAGG + Intronic
903053493 1:20618831-20618853 TAGAACCTTGGGAAGGCTGATGG - Exonic
903253894 1:22078751-22078773 AAAATCAGTGGAAAGTCAGAAGG + Intronic
904862470 1:33549176-33549198 AAGAACAGTGGCACATCTTATGG + Intronic
904956920 1:34292394-34292416 GAAAGCAGTGGGAACTCTGAAGG - Intergenic
905740070 1:40362252-40362274 AAGAACAGTGGGAAATCAGAGGG - Intronic
906237958 1:44223163-44223185 CAGAACAGTGGAAAGACAGATGG + Intronic
906923508 1:50089874-50089896 AAGTACAGTGGGAATACAGACGG + Intronic
907261057 1:53218987-53219009 AAGAACAGTGGGAGGTGGGCAGG + Intronic
907972347 1:59395684-59395706 AAGAATATTGGGAGGACTGAAGG - Intronic
909024824 1:70469611-70469633 AAGTCCAAAGGGAAGTCTGATGG - Intergenic
911733049 1:101309707-101309729 AAGAACAAAGGGAAGTCGGAAGG - Intergenic
911785469 1:101941106-101941128 CAGAAAAGTGCGAAGTGTGATGG + Intronic
911856647 1:102885332-102885354 AAAAACAGTTGGAAGTATAAAGG - Intronic
912710555 1:111946687-111946709 CTGAAAAGTGAGAAGTCTGAAGG + Intronic
913055631 1:115156687-115156709 AACAATAGTGGCAAGACTGAGGG - Intergenic
913149227 1:116024034-116024056 AAGTACAGTGGGAAGCCAGTGGG + Intronic
915297157 1:154929526-154929548 AACTAAAGTGGGAAATCTGAGGG + Intronic
916979750 1:170121132-170121154 AAGAACAGTGTCAAGGCTCAGGG - Intergenic
917191367 1:172422596-172422618 AAGAACAGAGGGAAGAATAAAGG + Intronic
917337019 1:173934872-173934894 AAGAACTCTGGAAAGTCTGATGG + Exonic
917990526 1:180372728-180372750 AAGAACACTGGAAAATCTTATGG - Intronic
918837125 1:189481243-189481265 AAAAACAGAAAGAAGTCTGAGGG - Intergenic
919934369 1:202241776-202241798 AAGCACAGTGGCAAGACTAAAGG + Intronic
921311826 1:213852038-213852060 GAGAACAGTGGGCAGTATGTGGG - Intergenic
921884168 1:220287788-220287810 AGGAACAGTGGGGATTCTGCAGG - Intergenic
922208010 1:223465919-223465941 ATGAACAATGGCAAGGCTGATGG - Intergenic
923727482 1:236519805-236519827 AAGAACACTGGGTAGTATGTTGG - Intronic
924805453 1:247358006-247358028 AAGAACAGTGGGAAGTGCATGGG + Intergenic
1063999351 10:11650409-11650431 CAGAAAAGTGGGAAGTGTGGTGG + Intergenic
1064811634 10:19206527-19206549 GTGAACACAGGGAAGTCTGAGGG - Intronic
1064910785 10:20399587-20399609 AAGGACAGTGTGAAGGCAGAGGG + Intergenic
1064974162 10:21096232-21096254 AAGGACAGTGGGAAGAGAGAGGG - Intronic
1066242207 10:33549214-33549236 ATGAACAGCGGGATGTCTGGAGG + Intergenic
1066305332 10:34134801-34134823 AACAACAATTGGCAGTCTGAAGG + Intronic
1067689847 10:48494716-48494738 AAGAACAGTAGGCCCTCTGAAGG - Intronic
1068071999 10:52207194-52207216 AAAAACAGTGGGAAGGCTGTAGG + Intronic
1069732269 10:70624903-70624925 AGGAACAGTGGGAATGCAGATGG + Intergenic
1069961315 10:72080963-72080985 GAGAACAGCGGGAGGTGTGAGGG + Intronic
1071302345 10:84265426-84265448 GAGAACAGAGGGAAGACTTAAGG - Intergenic
1072289270 10:93947683-93947705 AAACACAGTGGGAAGTAGGATGG + Intronic
1073097060 10:100986412-100986434 AAACACAGTGAGAGGTCTGAAGG - Intronic
1074897306 10:117788193-117788215 AAGAACAGGGGTAAGTGAGAGGG + Intergenic
1075357007 10:121788652-121788674 AAGATCAATGGAAAGTCTGGAGG - Intronic
1076310739 10:129505858-129505880 GAGAGCAGTGTGAAGCCTGAGGG + Intronic
1079199847 11:18367366-18367388 AAGAGAAATGGGAAGACTGAAGG - Intergenic
1079388871 11:20003713-20003735 CAGAACAGTGGGAGGTGTGCAGG - Intronic
1080271144 11:30451966-30451988 AAGAAATGTGGGAAGTAGGAGGG + Intronic
1080281539 11:30563143-30563165 AAGGAGAGTGGGATGTCTGGGGG - Intronic
1080371749 11:31655508-31655530 AACAACAGTGGGAACTAGGATGG - Intronic
1080829366 11:35877071-35877093 AAGAAATGTCGGATGTCTGAAGG + Intergenic
1081069818 11:38596709-38596731 AAAAACAGGGGGATGTCTGTTGG - Intergenic
1083103298 11:60333007-60333029 AGGAAAAGAGGGAAGTGTGAAGG - Intergenic
1083489081 11:63001566-63001588 CAGAACAGCAGGAAGCCTGACGG - Intronic
1086400398 11:86456731-86456753 CAGAACAATGGGAAATCTGATGG + Intronic
1087078718 11:94150035-94150057 AAGCACTGTGGGAAGTCAGTGGG + Intronic
1087701518 11:101441191-101441213 AAGACCAGTGTGAAGTTTGGAGG + Intergenic
1088000918 11:104879179-104879201 AAGAAGTGTGGGAAGAATGAAGG + Intergenic
1088107279 11:106221598-106221620 AAGAGCAATGGGAAAACTGAGGG + Intergenic
1088141699 11:106624401-106624423 AAGGACAGAGGGATGTGTGAGGG - Intergenic
1088554096 11:111044017-111044039 AAGAGAAGGAGGAAGTCTGATGG - Intergenic
1088671547 11:112146112-112146134 AAGTGCACTGGAAAGTCTGAGGG + Intronic
1089134250 11:116236529-116236551 AAAGACGGTGGGAAGTCTGGAGG + Intergenic
1089166404 11:116480626-116480648 ATGAACAGTGGGAAGATGGATGG + Intergenic
1089799965 11:121019389-121019411 AAGATCATTGTGAAGACTGAGGG + Intergenic
1090285282 11:125495002-125495024 AGGAGCAGTGGGAAATCTGAAGG - Intronic
1090655165 11:128837672-128837694 AAGAACAGTGGGAAGTCTGATGG - Intronic
1091014811 11:132040347-132040369 AGGTAAAGTGGGAAGTATGATGG + Intronic
1091891367 12:4057266-4057288 ATGTGCAGTGGGAAGTCAGAAGG + Intergenic
1092437188 12:8459198-8459220 AAAAAAAGAAGGAAGTCTGAAGG - Intronic
1094162165 12:27402893-27402915 AAGCACTGTGGGAATTTTGAGGG - Intronic
1095947674 12:47763085-47763107 AGGAACAGTGGGCAGTCAGCTGG + Intronic
1097832146 12:64236619-64236641 AAAATCATTGGGAAGTCTAAAGG + Intergenic
1098539606 12:71639699-71639721 AAGGACAGTGGGAAGGTAGAGGG + Intronic
1099358436 12:81667199-81667221 AGGCACAGTGAAAAGTCTGAGGG - Intronic
1099540961 12:83907221-83907243 AAGAAGGGTGGGAAGTGGGAGGG + Intergenic
1100236646 12:92668328-92668350 AAGACCACTGTGAATTCTGATGG + Intergenic
1101505690 12:105344329-105344351 AAGAACAGTGTGGAATCAGAAGG - Intronic
1101980282 12:109399967-109399989 CAGAACAGTGGGCAGTGGGAAGG - Intronic
1103276200 12:119713655-119713677 AAGAACAGTGAGCAACCTGAGGG + Intronic
1104988625 12:132611566-132611588 AAGAGCAGTGGGGACGCTGAGGG + Intergenic
1107316154 13:39134319-39134341 AAGAAAAGGGGGAAATATGAAGG - Intergenic
1110955089 13:81544482-81544504 AAGAAAAGTGGGCAGTCTTTTGG - Intergenic
1111734602 13:92121719-92121741 AATGACATTTGGAAGTCTGAAGG - Intronic
1112708902 13:102103962-102103984 AAACACAGTGGGAAGTGAGAAGG - Intronic
1115041271 14:28932003-28932025 AAGAATAGTGGGAGTTCTGGTGG - Intergenic
1115119812 14:29926908-29926930 AAGAAAACTGGGAAGTCTCAAGG + Intronic
1116004307 14:39276052-39276074 AAGAACAATCTGAAGTATGATGG - Intronic
1116984496 14:51204523-51204545 AAGATCCGTTCGAAGTCTGATGG + Intergenic
1117341490 14:54795915-54795937 ACCGACAGTGGGAAGTCTAAAGG - Intergenic
1117419272 14:55528229-55528251 AATAAAAGTGGGGAGTCTAATGG + Intergenic
1117512162 14:56463461-56463483 GAGAGCAGTGGGAATTCTGTAGG + Intergenic
1118879450 14:69813720-69813742 AATACCAGTGGGAACTTTGATGG - Intergenic
1119896247 14:78222193-78222215 ATGAACAGTGGGAATTCTGGAGG + Intergenic
1123435984 15:20254814-20254836 GAGAACAGTGGGGAGGGTGAGGG - Intergenic
1125006156 15:34820206-34820228 AAGAAAAGTGGCCAGGCTGAAGG + Intergenic
1125343177 15:38694427-38694449 AAGAACAGTGAGAAGGCTGGTGG + Intergenic
1125968569 15:43893804-43893826 AAGAACAGTGGGGCCTCTGCAGG + Intronic
1126047917 15:44661282-44661304 AACAACACTGGCAAGACTGATGG + Intronic
1127289719 15:57559599-57559621 AAAAGCAGTGGGAAGCCAGAGGG - Intergenic
1131146903 15:90020087-90020109 GGGAACAGAGGGAAGTTTGATGG + Intronic
1131650118 15:94389093-94389115 AAGGGCAGTGGGAAGTAGGACGG + Intronic
1132120179 15:99169284-99169306 CAGGGCAGTGGGAAGTCTGAAGG + Intronic
1133937009 16:10277624-10277646 AAGAAGAGGGGGAAGTAGGAGGG - Intergenic
1134156008 16:11843981-11844003 AAGCCCAGTGGGAAGCCTGGAGG + Intronic
1136848615 16:33596173-33596195 GAGAACAGTGGGGAGTGTGAGGG + Intergenic
1137874841 16:51986150-51986172 AAGAGAAGTGGGATGGCTGAGGG + Intergenic
1139213727 16:65107104-65107126 ATGACCAGTGGTAAGTCTCACGG + Intronic
1139476476 16:67205082-67205104 AATGGCAGGGGGAAGTCTGAGGG - Intergenic
1140534949 16:75701363-75701385 AAGAACAGAGAAAAGGCTGATGG + Intronic
1141175784 16:81718149-81718171 ACGGCCAGTGGGAAGTGTGATGG + Intergenic
1141362724 16:83411317-83411339 AAGAAAAGTGGGAGGTTTAATGG - Intronic
1142025102 16:87808380-87808402 GAGAACAGTGGGAGGTGAGATGG - Intergenic
1142119208 16:88377620-88377642 AAGGACAGAGGGAAGCTTGAGGG - Intergenic
1203110322 16_KI270728v1_random:1444822-1444844 GAGAACAGTGGGGAGTGTGAGGG + Intergenic
1143151056 17:4807747-4807769 AGGAACATTGGGAAGCCTCAGGG - Intronic
1144060977 17:11583256-11583278 AAGCACAGGAGGAAGACTGAGGG - Intergenic
1144457027 17:15427118-15427140 CAGAACTGTGCCAAGTCTGAGGG + Intergenic
1146531861 17:33614313-33614335 AACACCAATGGGTAGTCTGACGG - Intronic
1147366118 17:39960388-39960410 AATACCAGTAGGCAGTCTGAGGG + Intergenic
1147762227 17:42806284-42806306 AGGAACAGTAGGAAGCTTGATGG + Intronic
1147879302 17:43643630-43643652 GAGAACAGAGGGAAGCCGGAGGG - Exonic
1154121652 18:11657282-11657304 AGCAACAGTGGGAGGTTTGAGGG - Intergenic
1156258022 18:35417166-35417188 AAGGACACAAGGAAGTCTGAGGG - Intergenic
1156403517 18:36761458-36761480 AAGAACAGTGTGAATACTGTGGG - Intronic
1156676678 18:39535352-39535374 AAGAACAGTGAGGAGGATGATGG - Intergenic
1158498566 18:57979270-57979292 GAGAACAGTGGCAATTCTGGGGG - Intergenic
1158636459 18:59162810-59162832 AAGAACAGAGGGAGGCCAGAGGG - Intergenic
1160676919 19:395899-395921 AAGGACAATGGGAAGGATGATGG + Intergenic
1162042630 19:7979824-7979846 AAGATCATGGGGCAGTCTGAAGG + Intronic
1163049767 19:14673886-14673908 ATGAAGACTGGGAAGGCTGAGGG - Intronic
1163314346 19:16532056-16532078 AGCAACAGTGGGAAGGGTGAGGG + Intronic
1164463119 19:28465225-28465247 AGGAACAGTGGGAGGGTTGAGGG + Intergenic
1165032136 19:33005684-33005706 GAGAACAGTGGGGAGTGTGAGGG - Intronic
1165582371 19:36878199-36878221 AAGAACTGTGGGAAGGCTTATGG + Exonic
1166536215 19:43576584-43576606 ATGAACAGAGGGATGTCTGTCGG - Intronic
1167808706 19:51809728-51809750 AATATCAGTGGGAACTTTGATGG + Intronic
925460386 2:4057919-4057941 GACAAAAGTGGGAAGGCTGATGG - Intergenic
925709476 2:6724851-6724873 AAGAAAAGTGGGCAGAGTGAAGG - Intergenic
925822731 2:7816238-7816260 AAGAGCAGGAGGAAGTGTGATGG + Intergenic
927266955 2:21162397-21162419 AAGCACAGGGGGAAAGCTGAGGG - Intergenic
927989621 2:27438509-27438531 AAGACTAGTGGGAAGTCAGGAGG + Intronic
929138579 2:38647786-38647808 AAGAAAAGTGGAAACTCTTAAGG + Intergenic
929243461 2:39676504-39676526 GAGACCGGTGGGAAGTCTGCAGG - Intronic
929438440 2:41946854-41946876 AAGAACAGTGGTATGCATGATGG - Intronic
931906637 2:66850011-66850033 ATGAACAGAGGGCAGTGTGAGGG - Intergenic
932851861 2:75195345-75195367 AAGAAAAGTGGGAGGTGGGAAGG - Intronic
933678259 2:85076899-85076921 CAGTACACTGGGAAGTCAGATGG + Intergenic
935675452 2:105591468-105591490 AAGAACAGTGTCAGGTGTGAGGG - Intergenic
935736214 2:106108536-106108558 AAGAACAATGAGAAGGCTGAGGG - Intronic
936676641 2:114723323-114723345 AAGCACTGTGGGATGTCTAAAGG + Intronic
936944547 2:117918670-117918692 AAGAACAGGTGGCACTCTGAGGG - Exonic
937657890 2:124397919-124397941 AAGATAAATGTGAAGTCTGATGG - Intronic
937797168 2:126037338-126037360 AAGGGCAGTGGGAGGTGTGATGG - Intergenic
937992496 2:127672442-127672464 AAGAGCTGTGGCAAGTCTGAGGG - Intronic
938191960 2:129291520-129291542 CAGAACGGAGGGAAGCCTGAAGG + Intergenic
939079911 2:137647365-137647387 AAAAAGACTGGGAAGTTTGAAGG + Intronic
939660472 2:144882636-144882658 AACAACAGTGTGAAGTATGTTGG + Intergenic
939722824 2:145676650-145676672 AAGAAGAGTAGCAAGTCTAAAGG - Intergenic
943960175 2:194254257-194254279 AAGCACAGGAGAAAGTCTGAGGG + Intergenic
944297327 2:198081333-198081355 AAGAAAACTGTGAATTCTGATGG - Intronic
946831121 2:223729148-223729170 AAGCACAGTGGGAAGTACGTTGG - Intergenic
947827215 2:233114567-233114589 AGGATCAGTGTGGAGTCTGACGG - Intronic
947879824 2:233497960-233497982 AAGCTCTGTGGGGAGTCTGAGGG - Intronic
1169679268 20:8192287-8192309 AAGAATAGTATTAAGTCTGATGG + Intronic
1169680504 20:8207482-8207504 AAACACTGTGGAAAGTCTGAAGG + Intronic
1169777669 20:9273907-9273929 AAGAACAGGAGGAAGACTGCTGG + Intronic
1171773929 20:29348663-29348685 AAGAACAAAGGGAAATGTGAAGG + Intergenic
1171815936 20:29786216-29786238 AAGAACAAAGGGAAATGTGAAGG + Intergenic
1172499930 20:35418501-35418523 AAGAAGTATGGGAATTCTGAGGG - Intergenic
1172833085 20:37853178-37853200 AAGAACAGAGGGAAGTTAGCTGG - Intronic
1173378361 20:42511359-42511381 AGTAACAGTGGGAAGTCTAGGGG + Intronic
1174278826 20:49423541-49423563 AAGAACAGAGGGGAGTCAGAGGG + Intronic
1175506761 20:59491665-59491687 AACAACACTGGGATGGCTGATGG + Intergenic
1175886703 20:62296009-62296031 AAGAACGGTAGGAAGGCTGATGG + Exonic
1176076814 20:63252363-63252385 AAGAACAGTGTGAACTTTGCTGG - Intronic
1177089773 21:16753357-16753379 AAGAACAGTCAGAAGTTTCAAGG + Intergenic
1180319388 22:11306780-11306802 AAGAACAAAGGGAAATGTGAAGG + Intergenic
1181417211 22:22769068-22769090 AAGGACAGTGGGAAGCCTGAAGG - Intronic
1183259230 22:36783584-36783606 AAGCACAGTGGGAAGCCTTTGGG - Intergenic
1183918101 22:41139806-41139828 AAGAGCAGATGGAACTCTGAAGG + Intronic
1184406896 22:44305535-44305557 AAGGACAGTGTGCAGCCTGAAGG + Intronic
952257446 3:31707611-31707633 AAAAAAAATGGGTAGTCTGAGGG + Intronic
953358820 3:42277336-42277358 TAGAACATTGTGAGGTCTGAAGG + Intergenic
953490264 3:43344221-43344243 AAGCAAAGTGGGAAGGCTGGGGG - Intronic
954505378 3:51066209-51066231 AAGAACGGGGGAAATTCTGAAGG + Intronic
954574579 3:51668780-51668802 AGGAACAGAAGGAAGACTGATGG + Intronic
955240686 3:57175407-57175429 AAAAATAGTGGGAAGTCTGGTGG - Intergenic
956273351 3:67471218-67471240 GAGAACCCTGGGAAGTCTGAAGG + Intronic
956903511 3:73741576-73741598 AGGAACAGTAGGTAGTCTTAAGG + Intergenic
956923633 3:73958024-73958046 AAGAACAAAAGGAAGTCAGAAGG - Intergenic
956970166 3:74513916-74513938 AAACACATTGGGAAGTCTAATGG + Intronic
957773897 3:84730362-84730384 TAGAACAGTAGGAAGACAGACGG - Intergenic
958789181 3:98631137-98631159 GAGAAAAGTGGAAAGGCTGATGG + Intergenic
960465239 3:117989927-117989949 ACGAACAGTGGGCATTCTGTGGG - Intergenic
965237803 3:166149085-166149107 AAGAACAGTGGGAAATGAGATGG - Intergenic
966247799 3:177827855-177827877 AAGAACAGTGGGATTTGTGGGGG + Intergenic
967198057 3:187046539-187046561 AAGAACAGGGAAAAGTCAGAAGG + Intronic
967800267 3:193650650-193650672 AAGGACAGTGGAATGTCTAAAGG - Intronic
967848515 3:194063891-194063913 AGGAGCAGTGGGGAGTCAGAGGG - Intergenic
969987832 4:11229912-11229934 AAGAATAGGGTGAAGTGTGAAGG - Intergenic
971344302 4:25797975-25797997 AATCAAAGTGGGAAGTCAGAGGG + Intronic
973240430 4:47950613-47950635 AAAAACAATGGGAAGGCTGGAGG + Intronic
974328735 4:60449011-60449033 AAAAACAGTGAGAAGTATGGTGG + Intergenic
975061315 4:70005135-70005157 AGGAACAGTAGGAAGAGTGATGG - Intergenic
975474394 4:74806408-74806430 AAGTACAGTGGAAAGTATCAGGG + Intergenic
975901581 4:79159704-79159726 AAGAACAGAGGGAAGGATAATGG - Intergenic
976097964 4:81528804-81528826 AAGAACAGTGGGAGATGGGAAGG - Intronic
976239956 4:82944832-82944854 GAGATCAGAGGGTAGTCTGAAGG - Intronic
976688908 4:87846959-87846981 CAGCACAGAGGGAAGTCAGAGGG - Intergenic
977628838 4:99218951-99218973 AAGAACTGAGGGAAGTCAAAAGG + Intronic
978866224 4:113514590-113514612 AAGAATAGTGTGAAATTTGAGGG - Intronic
979641228 4:123014101-123014123 AAAAACAGAGGGAAGACAGAGGG - Intronic
980367690 4:131826904-131826926 CAGTTCAGTGGAAAGTCTGAAGG + Intergenic
981416086 4:144495042-144495064 AAGAACACTGCAAAGTCAGATGG + Intergenic
981944542 4:150325904-150325926 AAGGGCAGGGGCAAGTCTGAAGG + Intronic
982973039 4:162015278-162015300 AAGAAAAAAGGGAAGTGTGACGG + Intronic
983334613 4:166375840-166375862 GAGGACAGTGGGTAGTCTGAAGG + Intergenic
983832640 4:172347420-172347442 AAGAACACTGTGAAGTGTAATGG + Intronic
987033137 5:13994111-13994133 AAGTGCAGTGGGAAGCCTGTAGG - Intergenic
989154910 5:38335393-38335415 AAGAGTAGTGGGAAGTTGGATGG - Intronic
991912379 5:71574552-71574574 AATACCAGTGGGAACTTTGATGG - Intergenic
992636656 5:78731176-78731198 TGGTACAGTAGGAAGTCTGAAGG + Intronic
992781578 5:80132906-80132928 AAGAGCAGTGAGAAGGCTGTTGG + Intronic
993300142 5:86198585-86198607 AAGAACAGTGAGAAAGCTGGAGG + Intergenic
994267832 5:97738893-97738915 CATACCAGTGTGAAGTCTGAAGG + Intergenic
996357021 5:122606233-122606255 AAGAAGAGAGGGAATTGTGAAGG - Intergenic
997269990 5:132528304-132528326 AAGAACAGCAGGAAGACAGATGG - Intergenic
997991042 5:138544464-138544486 AAGAACAGTGGGTAGTTTAAAGG + Intergenic
998393085 5:141800279-141800301 AAGAAGGGTGGGTGGTCTGAGGG - Intergenic
999574014 5:152953780-152953802 AAGGAAGGTGAGAAGTCTGACGG + Intergenic
1000182937 5:158830204-158830226 AAGAGCAGAGGCAAGCCTGAAGG + Intronic
1000381659 5:160635146-160635168 AAGAAAAGAGGGTAGACTGATGG + Intronic
1000725556 5:164765802-164765824 AAGAAAATTGGGATTTCTGAGGG - Intergenic
1001270263 5:170305933-170305955 AAGAACAATGGCAGGGCTGAGGG - Intergenic
1001296175 5:170500647-170500669 AAGAACACAGGTAAGTGTGAGGG - Intronic
1001430791 5:171660418-171660440 GAGAAAACTGGGAAGTCTGATGG + Intergenic
1004433663 6:15569155-15569177 AGGAACAGTGGGGAGGCAGATGG - Intronic
1004522570 6:16375924-16375946 AAGCCCAGTGGGAAATCTGTAGG - Intronic
1005154260 6:22785606-22785628 AGGTACAATGGGAAGTGTGAAGG + Intergenic
1007028465 6:38603127-38603149 AAGAACAGTAGGAAGGCAGGGGG + Intronic
1007881274 6:45170034-45170056 GAGAGAAGTGGGAAGTATGAAGG - Intronic
1007905474 6:45455653-45455675 TAGCACAGTGTGAAGTGTGATGG + Intronic
1008242080 6:49126292-49126314 AAGAAAATGGGGAAGTCAGAAGG + Intergenic
1008831689 6:55771611-55771633 AAGAACATCAGGAAGTCAGAAGG + Intronic
1010511381 6:76724600-76724622 AAGAACAGTGTGAGGTTTCATGG - Intergenic
1013288199 6:108698405-108698427 AAGAAAAGAGGGAAGTCTGATGG + Intergenic
1013835437 6:114329641-114329663 AAGCACAGCAGGAAGTATGAAGG + Intronic
1014801893 6:125787755-125787777 AAGAACAGTGAAAAGTGTTAGGG + Intronic
1014999646 6:128199416-128199438 AAGAACAGTGGTTACTCTGGGGG + Intronic
1015411744 6:132901241-132901263 GAGATTAGTGGGAAATCTGATGG + Intergenic
1015705482 6:136083193-136083215 GAGAACAGTCGGAAGACTGAGGG + Intronic
1016135547 6:140537322-140537344 AATACCAGTGGGATGACTGAAGG + Intergenic
1017209280 6:151837106-151837128 AAAAAAAGAGGGATGTCTGAAGG - Intronic
1017695529 6:157011740-157011762 GACAACAGTAGGAAGTCTTATGG - Intronic
1018704267 6:166450948-166450970 CAGAACAATGGGAAGTGTGAGGG + Intronic
1019120538 6:169800525-169800547 AAGATCAGAGGGAAATGTGAGGG + Intergenic
1020792688 7:12645406-12645428 CAGAACAGTAGCATGTCTGAAGG - Intronic
1021829960 7:24596083-24596105 AAGTACAGTGGGAAGCCTTTGGG + Intronic
1022427322 7:30281894-30281916 AACAAGAGTCCGAAGTCTGATGG + Intergenic
1022590907 7:31661785-31661807 AAGAAAGATGGGAAGTGTGATGG - Intergenic
1023541214 7:41268284-41268306 AAGTACAGTGAAAAGTCTGGTGG + Intergenic
1024278501 7:47698437-47698459 CAGAAGAGTGGGAAGACAGAAGG + Intronic
1024334835 7:48196609-48196631 CAAAACAGTGGGAAGCATGAGGG - Intronic
1025941065 7:66076402-66076424 AGGAAGAGTTGGAAGGCTGAAGG - Intronic
1026352060 7:69526200-69526222 AGGAACACTGGGAAGACTGGAGG - Intergenic
1026545164 7:71316105-71316127 AAGCACAGAGGGAAGTCTGGTGG - Intronic
1026902060 7:74042929-74042951 AGGAACAGTGGGGAGGCAGAAGG - Intronic
1030359446 7:108579785-108579807 AGGAACAGTGTGAAGCCTGGGGG + Intergenic
1030644683 7:112046867-112046889 AAAAAGAGTTGGGAGTCTGAGGG + Intronic
1033394698 7:140962418-140962440 TAGAACAGTGTGAAATTTGAAGG - Intergenic
1035096840 7:156362634-156362656 AACAACAGTGTGAAGATTGAGGG - Intergenic
1035452849 7:158989618-158989640 AAGAACAGTGGGAAATAGGCTGG + Intergenic
1036111218 8:5905051-5905073 GAGAACAGAGGCAAGTCTGCCGG + Intergenic
1038324795 8:26564696-26564718 AGGACCAGTGGGAAGTCTTCAGG + Intronic
1039906024 8:41787064-41787086 AAGCACAGAGGGATGCCTGATGG + Intronic
1040447248 8:47507864-47507886 CAGAAGAGTGGGAAGTCCCAAGG - Intronic
1040985290 8:53287148-53287170 AGGAACAATGCGAAGTTTGAGGG - Intergenic
1042210884 8:66379232-66379254 AATAACTGTGGGCAGTCTGGTGG - Intergenic
1042990197 8:74630769-74630791 AAGAAGAGTGGAAAGTGTTAAGG + Intronic
1044736209 8:95281343-95281365 CAGAAAATTGGGAAGTCAGAAGG - Intergenic
1047249821 8:123173692-123173714 AAAAACCGTGGGACCTCTGATGG - Intergenic
1047440254 8:124871371-124871393 TGGAATAGTGGGAACTCTGAGGG - Intergenic
1048225223 8:132578768-132578790 AAGGAAAGTGGGAACTCAGAAGG + Intronic
1048317914 8:133375563-133375585 GAGGGCAGTGGGAAGGCTGAAGG + Intergenic
1050607661 9:7318071-7318093 AAGAGTACTGGGAAGTCTGCAGG - Intergenic
1053137934 9:35663399-35663421 TTCAACAGTGGGAAGTCTGAGGG + Intronic
1053361223 9:37487954-37487976 AGGGACAGTGGGAAGGGTGATGG + Intronic
1053435478 9:38070842-38070864 AGTAACAGTGGGAACTGTGAGGG + Intergenic
1053506636 9:38649027-38649049 AAGAACTATGGGGAGGCTGAAGG - Intergenic
1054872043 9:70056392-70056414 AACAACAGTGGGATTTCAGATGG - Intronic
1055185048 9:73441421-73441443 AGGTACAGTGGGCACTCTGATGG + Intergenic
1055188649 9:73490310-73490332 CATAACAGTGCGATGTCTGAAGG + Intergenic
1060461927 9:123864495-123864517 TTGTACTGTGGGAAGTCTGATGG + Intronic
1061191093 9:129083173-129083195 AAGGGCAGTGGGAGGCCTGAGGG + Intronic
1061503982 9:131020262-131020284 AAGAACAGTGGGTGGCCAGATGG - Intronic
1203367623 Un_KI270442v1:272530-272552 AAGAACAAAGGGAAATGTGAAGG + Intergenic
1186330969 X:8533992-8534014 AAGAAGAGAGGGAAGAATGAAGG + Intronic
1186598124 X:11006646-11006668 AATAACAGAGGGAAGTGTTAAGG + Intergenic
1186798893 X:13073241-13073263 AGGAACTGTGGGCAGTCTCAAGG + Intergenic
1187065161 X:15827737-15827759 AAGAACTGTGGGAACTCGGAGGG - Intronic
1187753861 X:22498122-22498144 AAGAACAGTGGTGACTCTCAAGG + Intergenic
1187885457 X:23884854-23884876 AAAAAGAGGGGCAAGTCTGAGGG + Intronic
1188603316 X:31996321-31996343 AAGAACAGTAGGTAATTTGAGGG + Intronic
1188812491 X:34668442-34668464 AAAAACATTTGGAAGTGTGAAGG - Intergenic
1189228972 X:39437144-39437166 GAGCACAGTGAGAATTCTGAGGG - Intergenic
1189232506 X:39463604-39463626 AAGAACAGTGGGAGGCTTCAGGG + Intergenic
1189314159 X:40041979-40042001 AAGAAAAGTGGCCAGGCTGATGG + Intergenic
1191139854 X:57105272-57105294 AATACCAGTGGGAACTTTGATGG - Intergenic
1191226376 X:58048759-58048781 GAGAAAGGTGGGAAGACTGATGG - Intergenic
1191630430 X:63315773-63315795 GACAACAGTGGAAAGGCTGATGG + Intergenic
1191668658 X:63728911-63728933 AAGAAGACTGGGAAATGTGATGG + Intronic
1192634397 X:72804131-72804153 GAGAACAGTCGGAAGACTGCTGG - Intronic
1192647313 X:72916670-72916692 GAGAACAGTCGGAAGACTGCTGG + Intronic
1194579922 X:95659415-95659437 AAGGACTGTGGGAAGCCTTAAGG + Intergenic
1194965233 X:100280770-100280792 AAGAATAGTGGGAAGTGGGTGGG - Intergenic
1195842156 X:109185896-109185918 AAAAACAGGGGCAAGTCTAATGG + Intergenic
1196023468 X:111014592-111014614 AAGGACAATTGGAAGTCTCATGG - Intronic
1196618585 X:117796000-117796022 AAGAGCAGTGGGAAGTGGGAAGG + Intergenic
1197044127 X:121975880-121975902 GAGAAAAGTGGAAAGGCTGATGG - Intergenic
1197816335 X:130502407-130502429 AAGAACAGTGGGAGGAAGGAAGG - Intergenic
1199323942 X:146475335-146475357 CAGCACAGTGGGAAGTCTCAGGG + Intergenic
1200413525 Y:2885325-2885347 AAAACCAGTGGGAACTTTGATGG + Intronic
1201071070 Y:10147737-10147759 AAGAACAAAGGGAAATGTGAAGG - Intergenic
1201368786 Y:13237862-13237884 CAGAACAGTAGGGAGTCTGTTGG - Intergenic