ID: 1090655223

View in Genome Browser
Species Human (GRCh38)
Location 11:128838101-128838123
Sequence GCATCATTCCGAATGTGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 57
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 51}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090655223_1090655228 25 Left 1090655223 11:128838101-128838123 CCAGGACACATTCGGAATGATGC 0: 1
1: 0
2: 1
3: 4
4: 51
Right 1090655228 11:128838149-128838171 ACAGTAAAACTTTCCCCTCAAGG 0: 1
1: 0
2: 0
3: 15
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090655223 Original CRISPR GCATCATTCCGAATGTGTCC TGG (reversed) Intronic